ID: 925018931

View in Genome Browser
Species Human (GRCh38)
Location 2:553581-553603
Sequence CTGTGTTCCCAGGAGGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925018924_925018931 8 Left 925018924 2:553550-553572 CCTGTGCTCCTAGCAGAAGGTGT No data
Right 925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG No data
925018927_925018931 0 Left 925018927 2:553558-553580 CCTAGCAGAAGGTGTGAGGGTCG No data
Right 925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925018931 Original CRISPR CTGTGTTCCCAGGAGGAGGT CGG Intergenic
No off target data available for this crispr