ID: 925019921

View in Genome Browser
Species Human (GRCh38)
Location 2:560365-560387
Sequence CCTCAGGTACTGCAAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925019921_925019926 -3 Left 925019921 2:560365-560387 CCTTCTCCTTGCAGTACCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 263
Right 925019926 2:560385-560407 AGGGACATCCTTCTCCATTCAGG 0: 1
1: 2
2: 4
3: 47
4: 186
925019921_925019928 5 Left 925019921 2:560365-560387 CCTTCTCCTTGCAGTACCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 263
Right 925019928 2:560393-560415 CCTTCTCCATTCAGGACCTGAGG 0: 1
1: 2
2: 27
3: 58
4: 303
925019921_925019931 29 Left 925019921 2:560365-560387 CCTTCTCCTTGCAGTACCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 263
Right 925019931 2:560417-560439 TGTCCTTCTCTGTACTCCCTTGG 0: 1
1: 0
2: 1
3: 37
4: 330
925019921_925019932 30 Left 925019921 2:560365-560387 CCTTCTCCTTGCAGTACCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 263
Right 925019932 2:560418-560440 GTCCTTCTCTGTACTCCCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925019921 Original CRISPR CCTCAGGTACTGCAAGGAGA AGG (reversed) Intergenic
901222137 1:7589247-7589269 CCTCAGGTCTACCAAGGAGAGGG + Intronic
902559768 1:17270219-17270241 CCTCAGGACCTGGAAGGGGAGGG - Exonic
903656298 1:24950652-24950674 CCCCAGATACTCCAAGCAGAGGG - Intronic
904392144 1:30193020-30193042 CCTCAGGTGCAGCTGGGAGAAGG - Intergenic
904709127 1:32415134-32415156 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
906009538 1:42510736-42510758 CCTAAGGTCCTGCAATGAGAAGG + Intronic
906290049 1:44613990-44614012 CCTCTGGAGCTGCAAGGAGGAGG + Intronic
906459003 1:46023164-46023186 CCACAGCTTCTGCAAGGATATGG + Intronic
907251337 1:53141759-53141781 CCTCAGGTGCTGAGTGGAGAGGG - Intronic
907814161 1:57901734-57901756 GTTCAGGCACTGCAAAGAGAAGG + Intronic
910192250 1:84606042-84606064 CCTAAGGTCCTGCAATGAGAAGG - Intergenic
911160657 1:94679827-94679849 CATCATGTTCTGCAAGGAGATGG + Intergenic
912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG + Exonic
912609577 1:111029476-111029498 CCTAAGGTTCTGTAATGAGAAGG - Intergenic
913669486 1:121082529-121082551 CCTCACCTACTGCATTGAGAGGG - Intergenic
914021240 1:143869927-143869949 CCTCATCTACTGCATTGAGAGGG - Intergenic
914659733 1:149777851-149777873 CCTCACCTACTGCATTGAGAGGG - Intergenic
915403503 1:155641683-155641705 TCTAAGGTCCTGCAATGAGAAGG + Intergenic
915511925 1:156391247-156391269 CCTCAGGCCCTGCCAGGGGAGGG + Intergenic
917187669 1:172378853-172378875 CCACTGGTTCTGAAAGGAGATGG - Intronic
917273683 1:173306419-173306441 CCTCAGGGACTGGAGTGAGATGG + Intergenic
917634805 1:176925047-176925069 CCTCAGGCACTGGAAGGAATTGG - Intronic
919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG + Intronic
920261727 1:204692912-204692934 CCTCAGGTTCTGCAAGTACAGGG - Intergenic
920284313 1:204868673-204868695 CCGCAGGAACTGCAAAGCGATGG + Intronic
923493006 1:234501033-234501055 CCTCAGGTCCTGGAATGATAAGG + Intergenic
924101942 1:240612625-240612647 CCTCAGTTACTGCAAACAAAAGG - Intergenic
924553141 1:245097135-245097157 CCTCAGGGACTTCATGGAAAGGG + Intronic
924711217 1:246531391-246531413 CCTAAGGTTCTGCAATTAGAAGG - Intergenic
1063636684 10:7788622-7788644 TCTCAGGGCCTGCAAGGTGACGG + Intronic
1064382502 10:14858953-14858975 CCCCAGGTACTAAAATGAGAAGG - Intronic
1064561511 10:16599180-16599202 TCTCAGGAACTGCAAGGAATAGG - Intronic
1067216907 10:44310931-44310953 CCTGGGGGACTGCATGGAGAAGG + Intergenic
1067799721 10:49350685-49350707 CCTCAGGGACAGCATGGAGGAGG + Intergenic
1067960099 10:50838578-50838600 CCTCAGCTTTTGAAAGGAGATGG - Intronic
1068061399 10:52072114-52072136 TCTCAGGTGCTGGAAAGAGAAGG - Intronic
1068496518 10:57790476-57790498 CCTAAGGACCTGCAATGAGAAGG - Intergenic
1069999428 10:72365314-72365336 CCTCAGGCACTCCTAGGAGCTGG + Intergenic
1070775095 10:79104786-79104808 CCTTAGGTACTGCTAGTAGGAGG + Intronic
1070813514 10:79310159-79310181 CCTCTGGGACTCCAAGGACAAGG - Intronic
1071712828 10:88066465-88066487 CCCCATGTAATGAAAGGAGATGG + Intergenic
1071742475 10:88375884-88375906 CCTGAGGTACAGAAAGGAGTAGG + Intronic
1071902641 10:90137381-90137403 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
1072248490 10:93563552-93563574 GCTCGGGTACTGCAGGGAAATGG + Intergenic
1072403512 10:95128641-95128663 CCTAAGGTCCTGCAATAAGAAGG + Intergenic
1072855029 10:98937292-98937314 ACTCAGGAAGTGCAAGGAGTCGG + Intronic
1074054236 10:109907674-109907696 CATCAGGTACTGCATGGCAATGG - Exonic
1075551452 10:123395638-123395660 CTCCAGGGACTGCAGGGAGAAGG - Intergenic
1076041500 10:127253461-127253483 CATCAGATTCTGCAAGGAAAAGG + Intronic
1078276208 11:9850082-9850104 CCTCAGCTCCTGCCAGCAGAAGG - Exonic
1079924889 11:26481650-26481672 CTTCAAGTATTGCATGGAGATGG + Intronic
1082228893 11:49740989-49741011 CCTGAGGTCCTGCAATGAGAAGG + Intergenic
1082800146 11:57408757-57408779 CCTCAGTTTCTGCAAAGAGCAGG + Intronic
1082883931 11:58064677-58064699 CCTCAGCCACAGCAAAGAGAGGG + Intronic
1083479013 11:62931735-62931757 CCTGAGCTACTGAAAGGACAGGG - Intergenic
1083530528 11:63417813-63417835 CTTCAGGCTCTGCAATGAGATGG - Intergenic
1084045002 11:66563332-66563354 CTTCAGGAACTAAAAGGAGATGG - Intergenic
1084632272 11:70361059-70361081 CCTCTGATTCTGTAAGGAGACGG + Intronic
1084887572 11:72221102-72221124 CCTCAGTCACTTCAAGGCGATGG + Intronic
1084955943 11:72691664-72691686 CCTCAGGAAATGCAAGGGGCAGG + Intronic
1085217968 11:74848884-74848906 CCCCAGGGACTCCGAGGAGAGGG + Intronic
1085618032 11:78016703-78016725 CCTCATGCACTGCCTGGAGATGG - Exonic
1086621175 11:88888133-88888155 CCTGAGGTCCTGCAATGAGAAGG - Intronic
1088483934 11:110323247-110323269 CCTAAGCACCTGCAAGGAGAAGG + Intergenic
1089103538 11:115983602-115983624 CCTCAGGTCCTGCAAAGGGAAGG - Intergenic
1091330448 11:134727742-134727764 CCCCAGGTCCTGCATGGAGTGGG - Intergenic
1094590642 12:31816557-31816579 CCTGCTGTACTGCAATGAGATGG + Intergenic
1095826004 12:46531074-46531096 CCTCAGGGCCTGCAAGGGCAAGG - Intergenic
1096045030 12:48554875-48554897 ACTAAGGTCCTGCAATGAGAAGG + Intergenic
1097728537 12:63101450-63101472 CCTCATGTGCTGCACCGAGAAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102220646 12:111192075-111192097 CCCCAGGTTCTGCAGTGAGAAGG + Intronic
1103133389 12:118487672-118487694 CCTCAGCTACTTCCTGGAGAGGG + Intergenic
1103859383 12:124000108-124000130 CCTCAGGGGCTGCATGGGGAAGG - Intronic
1104842924 12:131833202-131833224 CCTCAGGCACTGCAAGGCTGGGG - Intronic
1105519186 13:21116273-21116295 CTTCAGGGACTGCAGGGGGATGG - Intergenic
1110709811 13:78638064-78638086 CCTCTTGTGCTGAAAGGAGATGG - Intronic
1110953280 13:81521435-81521457 CCTAAGGTCCTGGAATGAGAAGG + Intergenic
1111012014 13:82325827-82325849 CCTAAGGTCCTGCAATGAGAAGG - Intergenic
1111770487 13:92590081-92590103 CCTGAAGTATTGCAAGGAGCTGG - Intronic
1111820914 13:93214229-93214251 CCTCAGGTTCTGCAATGTTATGG - Intergenic
1112434450 13:99381737-99381759 CATCAGGTTGTGCAGGGAGAGGG - Intronic
1113376288 13:109767316-109767338 CCTCCTGTCCAGCAAGGAGAAGG + Intronic
1113755083 13:112805281-112805303 CCTCTGGTACTAGAAGGAAAGGG - Intronic
1113828908 13:113278808-113278830 TCTCAGTTACTGAAAGAAGAGGG - Intergenic
1113846754 13:113396195-113396217 CCTCTAGTCCTGCAAGGAGCTGG - Intergenic
1114065475 14:19055580-19055602 CCTCAGGTCCTGGATGGAGGAGG - Intergenic
1114096786 14:19344421-19344443 CCTCAGGTCCTGGATGGAGGAGG + Intergenic
1115417935 14:33158587-33158609 TCTAAGGTACTGCAGAGAGAGGG + Intronic
1116286949 14:42986015-42986037 CCTCAGGGCCTGTAATGAGAGGG + Intergenic
1119572032 14:75683242-75683264 ACTCAGTTTCTGCAAGGATAAGG + Intronic
1122708945 14:103641275-103641297 CCTGAGGTACAACAAGGACAAGG - Intronic
1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG + Intronic
1124814572 15:32976357-32976379 GCTTAGGTAAGGCAAGGAGATGG + Intronic
1126670614 15:51112205-51112227 CCTCAGGGAGAGCCAGGAGAAGG + Intergenic
1128930804 15:71703535-71703557 CCTGAGATACAGCAAAGAGAGGG + Intronic
1129604182 15:77016772-77016794 AGTCAGGTGCTGGAAGGAGAAGG - Intronic
1129676826 15:77636247-77636269 CCCCAGGCACAGAAAGGAGAGGG + Intronic
1130059787 15:80561055-80561077 CCTCAAGACCTGCAAGGAGCAGG - Intronic
1132474315 16:125797-125819 CCTCAGCTACAGAAAGGAGAGGG + Intronic
1132598254 16:762853-762875 CCACAGGCACTCCAGGGAGAAGG - Intronic
1132643511 16:988498-988520 CCCCAGGTGCTGCACGGAGGAGG + Intergenic
1133058590 16:3159960-3159982 CCTCAGGACCTGGAAGGAAAAGG - Intergenic
1137469045 16:48738193-48738215 ACTGAGGTACAGCAGGGAGAAGG - Intergenic
1138345746 16:56319226-56319248 CCCCAGGTACTGCAGGGACTTGG - Intronic
1139476107 16:67203313-67203335 CCACAGGGACTGCAGGAAGAAGG - Exonic
1139708933 16:68761545-68761567 TCTCAGGTATTGCAGGGAGCAGG + Intronic
1141673912 16:85507534-85507556 CCTCCAGAACTGCAAGGAAATGG - Intergenic
1141913151 16:87074791-87074813 CCTCTGCTACTGCAAGGACCAGG + Intergenic
1142245998 16:88970300-88970322 CCTCAGGTGAAGCAAGGAGACGG + Intronic
1143289775 17:5820053-5820075 TCTCAGGTAATGGCAGGAGAGGG - Intronic
1144593033 17:16540865-16540887 CCAAAGGTCCTGCAATGAGAAGG - Intergenic
1144604532 17:16653383-16653405 CCTCAGGGCCTGCAAGGCGCGGG + Intronic
1146939318 17:36833163-36833185 ACTCAGCTCTTGCAAGGAGATGG + Intergenic
1149446676 17:56718575-56718597 CATCAGGAACTGGAGGGAGAGGG + Intergenic
1149543795 17:57488280-57488302 CCGCAGATGCTGCAAGGAGGCGG - Intronic
1151966705 17:77435268-77435290 CCTCAGGTTTTGCAATCAGAGGG - Intronic
1153229113 18:2920091-2920113 GCTCAGCTCCTGGAAGGAGAAGG - Exonic
1156305290 18:35873470-35873492 TCTAAGGTTCTGCAATGAGAAGG - Intergenic
1156890472 18:42184778-42184800 TCTCAGGTACTGCGAGGCGGAGG - Intergenic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1158014551 18:52768339-52768361 CCTCAGAAATTGCAGGGAGAAGG + Intronic
1158554827 18:58466486-58466508 CCTCGGCTACTGGAAGGGGAGGG - Intergenic
1159892368 18:73964613-73964635 CCTCAGGGACTGTGAGGGGAGGG + Intergenic
1162261201 19:9535572-9535594 CCTCAGCTTCCCCAAGGAGATGG - Intronic
1163569098 19:18069705-18069727 CCACTGGTTCTGGAAGGAGAGGG + Exonic
1164090645 19:21948609-21948631 CTTAAGGTCCTGCAATGAGAAGG - Intronic
1164194759 19:22946427-22946449 CTTAAGGTCCTGCAATGAGAAGG - Intergenic
1164395714 19:27861360-27861382 CCTCAGGCATTGTAAGGGGAGGG + Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1166438822 19:42792646-42792668 CCTAAGGTCCTGTAATGAGAAGG + Intronic
1166473832 19:43103433-43103455 CCTAAGGTCCTGTAATGAGAAGG + Intronic
1166487784 19:43228499-43228521 CCTAAGGTCCTGTAATGAGAAGG + Intronic
1166494619 19:43290371-43290393 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
1167720062 19:51173134-51173156 CTTCGGGTGATGCAAGGAGAAGG - Intergenic
1168098393 19:54128299-54128321 CCCCAGGTACCGCAAGATGAAGG + Exonic
1168582313 19:57565875-57565897 TCTAAGGTACTGCAATGATATGG + Intergenic
925019921 2:560365-560387 CCTCAGGTACTGCAAGGAGAAGG - Intergenic
925019927 2:560393-560415 CCTCAGGTCCTGAATGGAGAAGG - Intergenic
925472161 2:4174499-4174521 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
925902703 2:8519804-8519826 GGTCAGGTACTGCAGGAAGAGGG - Intergenic
927895682 2:26780299-26780321 CCTCAGCTCCTGCAAGGACCTGG + Exonic
927955501 2:27204801-27204823 CCTCAGTTCCCGCACGGAGAAGG - Exonic
928482124 2:31693514-31693536 CCTAAGGTCCTGCAATGAGAAGG + Intergenic
929393316 2:41495806-41495828 CCTAAGGTCCTACAATGAGAAGG - Intergenic
929957750 2:46471809-46471831 CCTCAGGCACTACTAGGAGTAGG - Intronic
931088579 2:58861968-58861990 CCTCAGAGACTGCAATGAGATGG + Intergenic
932126848 2:69152279-69152301 CCTCAGGCCATGCAAGGTGAAGG + Intronic
932734075 2:74242124-74242146 TCTAAGGAACTGGAAGGAGATGG - Intronic
934554951 2:95282136-95282158 CCTCAGGCAGTGCAAGGAAGGGG + Exonic
938009945 2:127820868-127820890 CCTAAAGTCCTGCAATGAGAAGG - Intergenic
938482892 2:131675864-131675886 CCTCAGGTCCTGGATGGAGGAGG - Intergenic
939866937 2:147483257-147483279 TCTCAGGTACTTCAAGGACCAGG - Intergenic
943984788 2:194605042-194605064 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
944110824 2:196129971-196129993 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
944111014 2:196131296-196131318 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
945406162 2:209451467-209451489 CCACAGCTACTGCCAGGAAAGGG - Intronic
946384398 2:219373787-219373809 TCTCAGGAGCTGCAAAGAGAAGG - Exonic
946626604 2:221618859-221618881 CCTCTGGGACTGGAAGGTGATGG - Intergenic
948756280 2:240161341-240161363 CCTCAGGCACCGCGAGGACACGG + Intergenic
1169343921 20:4815397-4815419 CCTCAGGTACTCTGGGGAGATGG - Intronic
1169348822 20:4851646-4851668 CCTCAGGTACAGAAAGCCGATGG - Intergenic
1169971820 20:11276892-11276914 CTTCAGGTGCTGCAGGGAGTAGG + Intergenic
1170485124 20:16807820-16807842 CCTATGGCACTGCAAGGAAATGG - Intergenic
1170962956 20:21041643-21041665 CCTCAGGAAATGAAGGGAGAGGG + Intergenic
1174046611 20:47738371-47738393 CCTTAAGAACTGCAAGGAAAAGG - Intronic
1174440118 20:50544704-50544726 TCTCAGGTACGGCAATGTGAAGG - Intronic
1175496688 20:59419367-59419389 CCTGGGGTTCTGGAAGGAGATGG + Intergenic
1175914349 20:62418850-62418872 CCCAAGATACGGCAAGGAGAGGG - Intronic
1176257515 20:64159934-64159956 CCTCAGGCCCTGCAGGCAGAGGG - Intronic
1176336803 21:5606596-5606618 CCACAGGTGCTGCATGGAGCTGG - Intergenic
1176390954 21:6214352-6214374 CCACAGGTGCTGCATGGAGCTGG + Intergenic
1176470465 21:7101822-7101844 CCACAGGTGCTGCATGGAGCTGG - Intergenic
1176494026 21:7483600-7483622 CCACAGGTGCTGCATGGAGCTGG - Intergenic
1176506616 21:7654783-7654805 CCACAGGTGCTGCATGGAGCTGG + Intergenic
1180223933 21:46377922-46377944 CCACAGGTACGGCAAGCAGACGG - Intronic
1180483958 22:15778173-15778195 CCTCAGGTCCTGGATGGAGGAGG - Intergenic
1180852933 22:19030371-19030393 GCTCCGGTACTGGAAGGAGGGGG + Intergenic
1180937307 22:19634202-19634224 CCTCCAGGACTGCAAGGAGTAGG + Intergenic
1181103690 22:20558679-20558701 CCTCAGCTGCTGCAAGGTGGGGG + Intronic
1181446220 22:22976868-22976890 TCTAAGGTCCTGCAATGAGAAGG - Intergenic
1183337509 22:37258824-37258846 CCTCAGGCCCTGCCAGGTGAGGG + Intergenic
1183978938 22:41528465-41528487 CTTCAGGGGCTGCAAGGAGAAGG - Exonic
1184157579 22:42678509-42678531 CCTCAGGTCCTGTGATGAGAGGG - Intergenic
949824612 3:8152595-8152617 GCTCAAGTAATGCAAGGTGATGG + Intergenic
953719901 3:45346364-45346386 CCTCAGGTTCTGCAACGTCAGGG - Intergenic
953784128 3:45897610-45897632 GCTAAGGTCCTGGAAGGAGATGG - Intronic
953787362 3:45921276-45921298 CCTCAGGTACTCCTGGGAAAAGG - Exonic
954296542 3:49677468-49677490 CCTCAGGTAGCCCCAGGAGATGG - Intronic
956283929 3:67589023-67589045 CATCAGGGAGTGGAAGGAGATGG - Intronic
958894397 3:99813909-99813931 CCACGTGTACTGCAAGGAGCAGG - Intergenic
959233152 3:103683549-103683571 CCTCTGGTACAGCAGGGAAAAGG + Intergenic
960086281 3:113594951-113594973 CCTCTGGTGCTGCCAGGTGAAGG - Intronic
960348835 3:116569053-116569075 CCTCTGGTAGTGGAAGGAAATGG + Intronic
962002181 3:131309475-131309497 CCTGAGCTACTGCAAGTAGGAGG - Intronic
963401813 3:144807247-144807269 ACCCAGGAACTGCAAGGAGTTGG - Intergenic
964132409 3:153304490-153304512 CCTCAGGGACTGAAAAGATAAGG + Intergenic
964427351 3:156568049-156568071 CCTCAGGACCTGTAATGAGAGGG - Intergenic
964961969 3:162438295-162438317 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
966399696 3:179535633-179535655 CATCAGGTATGGGAAGGAGAGGG + Intergenic
966632842 3:182097627-182097649 TCTCAGACACAGCAAGGAGAGGG + Intergenic
967542101 3:190679852-190679874 CCTAAGGTCCCGCAACGAGAAGG - Intergenic
967563014 3:190939519-190939541 CCTAAGGTTCTGAAAGTAGATGG - Intergenic
970594377 4:17586564-17586586 CCTCACTTTCTGCAAGGACAAGG - Intronic
972215815 4:36895790-36895812 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
975731652 4:77343443-77343465 CCTAAGGTCCTGCAATGAGAAGG + Intronic
975913128 4:79292413-79292435 CCTGAGTTAATGGAAGGAGATGG - Intronic
978019279 4:103787525-103787547 CCTAAGGTCCTGCAATGAGGAGG - Intergenic
978729668 4:112011076-112011098 CCTCTGTAACTGCAAGGACATGG + Intergenic
979465172 4:121028755-121028777 CCTCATGTACTTCAAAGTGAAGG - Intergenic
980175905 4:129344149-129344171 CATCGAGTACTGCCAGGAGATGG + Intergenic
981871262 4:149488694-149488716 CCTCAGGGACTGAAAAGAGGCGG - Intergenic
983062370 4:163174189-163174211 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
983064531 4:163193489-163193511 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
986398175 5:7351572-7351594 CCACATGTACAGCAAGGAGCAGG + Intergenic
986864116 5:11964947-11964969 CTTCAGGAAGTACAAGGAGAAGG - Intergenic
987418902 5:17694550-17694572 CCTCTGGGCCTGCAAGGAAATGG - Intergenic
987618828 5:20311916-20311938 CCTCAGCTTCTACAATGAGATGG - Intronic
990260431 5:54016022-54016044 CCTCAGCTACAGAAAGGAAAAGG - Intronic
994156099 5:96505897-96505919 CCTCAGGTACTCCAAGGTCAGGG - Intergenic
994367455 5:98931648-98931670 CCTCTGGTTTTGCAAGGACATGG - Intergenic
995369350 5:111401368-111401390 CTTCAGGAACTACAAGGAAATGG + Intronic
997473848 5:134131540-134131562 CCTCAGGTCCCTCAAGCAGAGGG - Intronic
999296018 5:150459879-150459901 CCCGAGGAACTGCAAGGAGGCGG + Intergenic
1001327805 5:170742108-170742130 CCTCAGGTAGAGCAGGGAGCGGG - Intergenic
1001563543 5:172685422-172685444 CCTCAGGTAGGGCAAGGGAAGGG + Intronic
1001661478 5:173396659-173396681 CCTCAGGGACTGGATGGGGATGG + Intergenic
1003244804 6:4374739-4374761 CCACAGGTAGAGCCAGGAGAGGG - Intergenic
1003524812 6:6888837-6888859 CATCAGGGGCTGGAAGGAGAAGG + Intergenic
1004529094 6:16437004-16437026 CCTGAGTAACTGGAAGGAGATGG + Intronic
1005119248 6:22371844-22371866 CCTAAGGTCCTGCAATAAGAAGG - Intergenic
1005181734 6:23114478-23114500 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
1005311403 6:24562934-24562956 CCTCATATACTCCCAGGAGATGG + Intronic
1006379969 6:33691704-33691726 CCTGAGGTCCTGGAAGGTGAGGG + Exonic
1009199801 6:60730434-60730456 CATCAGAAACTGCAAGGAGCTGG - Intergenic
1014014488 6:116514255-116514277 GCTCAGGTACTGAGATGAGATGG + Intronic
1014504885 6:122242844-122242866 CCTCAGGATCTGCTATGAGATGG - Intergenic
1015521378 6:134134999-134135021 CCTCAGAAGCTGCAAGTAGAGGG + Intergenic
1017212223 6:151869477-151869499 CCTGAGGTATTACAATGAGATGG + Intronic
1018555931 6:165050599-165050621 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
1018966557 6:168494907-168494929 CCCCAGGAACTGCAGGCAGAGGG - Intronic
1019911006 7:4100575-4100597 CCTCACGTGGTGGAAGGAGAGGG - Intronic
1020262722 7:6539701-6539723 CCTCAGGTACTGCGGGCAGGGGG - Exonic
1020350739 7:7215903-7215925 CCTAAGGTCCTGCAATGAGCAGG + Intronic
1028351817 7:89858440-89858462 CCTAAGGTCCTGTAATGAGAAGG - Intergenic
1028357081 7:89923526-89923548 CATCAGGTACAGCAAGAGGATGG - Intergenic
1030010822 7:105165172-105165194 CCTCAGGTAGAGGAAGGATAAGG + Intronic
1034943919 7:155249853-155249875 CCTCTGGGACAGCAAGGACAGGG + Intergenic
1035566998 8:647948-647970 CATCAGTTACTGAAAGGAGGAGG + Intronic
1036591272 8:10170755-10170777 CCTCAGTTCCTGCAAGGGGTTGG - Intronic
1037994695 8:23343624-23343646 TCTCAGGTCCTGCAAGGCGGTGG + Intronic
1038011045 8:23476012-23476034 CCTCAGGTACATGAAGGTGAGGG - Intergenic
1039167848 8:34706307-34706329 CCTCATGCACTGTAAGCAGAAGG - Intergenic
1040094674 8:43432196-43432218 CCTAAGGTTCTGTAATGAGAAGG - Intergenic
1040290989 8:46124477-46124499 CCCCAGGTGCTGCCAGGAGAAGG + Intergenic
1040397375 8:47012649-47012671 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
1040579712 8:48687949-48687971 CCTCAGGTAGTAAAGGGAGAGGG - Intergenic
1041378096 8:57222784-57222806 CCTGTGGTTCTGCAATGAGAAGG + Intergenic
1046193849 8:110833874-110833896 CCTAAGGGACTGTAATGAGAAGG + Intergenic
1047339137 8:123963377-123963399 CCTCAGCTTCTCCAAAGAGAAGG + Exonic
1048471012 8:134704134-134704156 GCTCAGGTAATGCAGGGAAAAGG - Intronic
1051219384 9:14832242-14832264 CCTAAGGTCCTGCAATGAGAAGG - Intronic
1052215646 9:25963298-25963320 CCTAAGGTTCCGCAATGAGAAGG + Intergenic
1053082917 9:35192553-35192575 CCTAAGGTACTGTAATGAGAAGG + Intronic
1056451645 9:86722502-86722524 CCTCAGGTAAGGGGAGGAGAGGG + Intergenic
1056655216 9:88503375-88503397 CCTCAGGCAGAGGAAGGAGAGGG + Intergenic
1056840174 9:89992429-89992451 CCTCAGATCCTGCACAGAGAAGG + Intergenic
1057698427 9:97344410-97344432 CCTCTGGTAGAGGAAGGAGAGGG - Intronic
1058124550 9:101176508-101176530 CCACAGATACTGCAAGAAGGTGG - Intronic
1062422116 9:136487787-136487809 CCCCAGGCACTGCTAGGAGCTGG + Intergenic
1203424850 Un_GL000195v1:28306-28328 CCACAGGTGCTGCATGGAGCTGG + Intergenic
1185956614 X:4497954-4497976 GCTCAGATACTGCAAGGACAAGG + Intergenic
1186193013 X:7084415-7084437 ACACATGTACTGCAAGGAAAAGG - Intronic
1186495869 X:10012860-10012882 CATCAGGTAGAGCAAGGAGTGGG - Intergenic
1189056429 X:37704109-37704131 CCTCAGGTACTTCAAAGACTAGG - Intronic
1190908031 X:54747243-54747265 CCTCAGCCACTGCTAGGGGATGG + Intergenic
1191204573 X:57820706-57820728 CCTAAGGTCCTGTAATGAGAAGG + Intergenic
1191245709 X:58226655-58226677 CCTCAGGCATTCCAAGGATAGGG + Intergenic
1193530537 X:82649578-82649600 CCTGAGGTCCTGCAATGAGAAGG + Intergenic
1193560764 X:83013566-83013588 GCTTAGGTCCTGCAATGAGAAGG + Intergenic
1193798138 X:85901937-85901959 CTTGTGGCACTGCAAGGAGATGG - Intronic
1194436423 X:93873479-93873501 CCTAAGGTCCTGAAATGAGAAGG + Intergenic
1196781776 X:119390010-119390032 CCTCAGGGAGTGCCAGGAGGTGG + Intergenic
1200080183 X:153572409-153572431 CCTCAGGTCCTCCAGAGAGAAGG + Intronic
1201396626 Y:13555381-13555403 CCTAAGGTCCTGCAATAAGAAGG - Intergenic
1201564953 Y:15355862-15355884 ACACATGTACTGCAAGGAAAAGG - Intergenic