ID: 925027441

View in Genome Browser
Species Human (GRCh38)
Location 2:621037-621059
Sequence ACGGTGGGGACTGAATCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925027441_925027450 23 Left 925027441 2:621037-621059 CCCAGGGATTCAGTCCCCACCGT No data
Right 925027450 2:621083-621105 CGCTTCCATCCCCGGAGCACAGG No data
925027441_925027451 24 Left 925027441 2:621037-621059 CCCAGGGATTCAGTCCCCACCGT No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027441_925027449 15 Left 925027441 2:621037-621059 CCCAGGGATTCAGTCCCCACCGT No data
Right 925027449 2:621075-621097 CACATAAACGCTTCCATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925027441 Original CRISPR ACGGTGGGGACTGAATCCCT GGG (reversed) Intergenic
No off target data available for this crispr