ID: 925027444

View in Genome Browser
Species Human (GRCh38)
Location 2:621051-621073
Sequence CACCGACTGTATGCACGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925027444_925027456 25 Left 925027444 2:621051-621073 CCCCACCGTGCATACAGTCGGTG No data
Right 925027456 2:621099-621121 GCACAGGGAGCCACGCCCTCAGG No data
925027444_925027451 10 Left 925027444 2:621051-621073 CCCCACCGTGCATACAGTCGGTG No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027444_925027457 29 Left 925027444 2:621051-621073 CCCCACCGTGCATACAGTCGGTG No data
Right 925027457 2:621103-621125 AGGGAGCCACGCCCTCAGGTCGG No data
925027444_925027450 9 Left 925027444 2:621051-621073 CCCCACCGTGCATACAGTCGGTG No data
Right 925027450 2:621083-621105 CGCTTCCATCCCCGGAGCACAGG No data
925027444_925027449 1 Left 925027444 2:621051-621073 CCCCACCGTGCATACAGTCGGTG No data
Right 925027449 2:621075-621097 CACATAAACGCTTCCATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925027444 Original CRISPR CACCGACTGTATGCACGGTG GGG (reversed) Intergenic
No off target data available for this crispr