ID: 925027451

View in Genome Browser
Species Human (GRCh38)
Location 2:621084-621106
Sequence GCTTCCATCCCCGGAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925027447_925027451 5 Left 925027447 2:621056-621078 CCGTGCATACAGTCGGTGCCACA No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027445_925027451 9 Left 925027445 2:621052-621074 CCCACCGTGCATACAGTCGGTGC No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027442_925027451 23 Left 925027442 2:621038-621060 CCAGGGATTCAGTCCCCACCGTG No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027444_925027451 10 Left 925027444 2:621051-621073 CCCCACCGTGCATACAGTCGGTG No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027441_925027451 24 Left 925027441 2:621037-621059 CCCAGGGATTCAGTCCCCACCGT No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data
925027446_925027451 8 Left 925027446 2:621053-621075 CCACCGTGCATACAGTCGGTGCC No data
Right 925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925027451 Original CRISPR GCTTCCATCCCCGGAGCACA GGG Intergenic
No off target data available for this crispr