ID: 925030602

View in Genome Browser
Species Human (GRCh38)
Location 2:647796-647818
Sequence TCCTGGGAACCTGGAAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030602_925030609 6 Left 925030602 2:647796-647818 CCGGCCCTTCCAGGTTCCCAGGA No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030602_925030607 -7 Left 925030602 2:647796-647818 CCGGCCCTTCCAGGTTCCCAGGA No data
Right 925030607 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
925030602_925030613 28 Left 925030602 2:647796-647818 CCGGCCCTTCCAGGTTCCCAGGA No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030602 Original CRISPR TCCTGGGAACCTGGAAGGGC CGG (reversed) Intergenic
No off target data available for this crispr