ID: 925030603

View in Genome Browser
Species Human (GRCh38)
Location 2:647800-647822
Sequence CAGATCCTGGGAACCTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030603_925030609 2 Left 925030603 2:647800-647822 CCCTTCCAGGTTCCCAGGATCTG No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030603_925030614 29 Left 925030603 2:647800-647822 CCCTTCCAGGTTCCCAGGATCTG No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030603_925030613 24 Left 925030603 2:647800-647822 CCCTTCCAGGTTCCCAGGATCTG No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data
925030603_925030615 30 Left 925030603 2:647800-647822 CCCTTCCAGGTTCCCAGGATCTG No data
Right 925030615 2:647853-647875 TTGTCAGCTGCTCCCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030603 Original CRISPR CAGATCCTGGGAACCTGGAA GGG (reversed) Intergenic
No off target data available for this crispr