ID: 925030604

View in Genome Browser
Species Human (GRCh38)
Location 2:647801-647823
Sequence GCAGATCCTGGGAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030604_925030615 29 Left 925030604 2:647801-647823 CCTTCCAGGTTCCCAGGATCTGC No data
Right 925030615 2:647853-647875 TTGTCAGCTGCTCCCGGCCTGGG No data
925030604_925030614 28 Left 925030604 2:647801-647823 CCTTCCAGGTTCCCAGGATCTGC No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030604_925030609 1 Left 925030604 2:647801-647823 CCTTCCAGGTTCCCAGGATCTGC No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030604_925030613 23 Left 925030604 2:647801-647823 CCTTCCAGGTTCCCAGGATCTGC No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030604 Original CRISPR GCAGATCCTGGGAACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr