ID: 925030606

View in Genome Browser
Species Human (GRCh38)
Location 2:647812-647834
Sequence CCGGGCATGCAGCAGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030606_925030618 24 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030618 2:647859-647881 GCTGCTCCCGGCCTGGGTCGGGG No data
925030606_925030615 18 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030615 2:647853-647875 TTGTCAGCTGCTCCCGGCCTGGG No data
925030606_925030613 12 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data
925030606_925030617 23 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030617 2:647858-647880 AGCTGCTCCCGGCCTGGGTCGGG No data
925030606_925030616 22 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030606_925030609 -10 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030606_925030614 17 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030606 Original CRISPR CCGGGCATGCAGCAGATCCT GGG (reversed) Intergenic
No off target data available for this crispr