ID: 925030608

View in Genome Browser
Species Human (GRCh38)
Location 2:647813-647835
Sequence GCCGGGCATGCAGCAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030608_925030616 21 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030608_925030615 17 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030615 2:647853-647875 TTGTCAGCTGCTCCCGGCCTGGG No data
925030608_925030617 22 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030617 2:647858-647880 AGCTGCTCCCGGCCTGGGTCGGG No data
925030608_925030613 11 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data
925030608_925030618 23 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030618 2:647859-647881 GCTGCTCCCGGCCTGGGTCGGGG No data
925030608_925030614 16 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030608 Original CRISPR GCCGGGCATGCAGCAGATCC TGG (reversed) Intergenic
No off target data available for this crispr