ID: 925030609

View in Genome Browser
Species Human (GRCh38)
Location 2:647825-647847
Sequence GCATGCCCGGCCTCACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030606_925030609 -10 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030598_925030609 20 Left 925030598 2:647782-647804 CCGGCCTCACTGCACCGGCCCTT No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030603_925030609 2 Left 925030603 2:647800-647822 CCCTTCCAGGTTCCCAGGATCTG No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030605_925030609 -3 Left 925030605 2:647805-647827 CCAGGTTCCCAGGATCTGCTGCA No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030602_925030609 6 Left 925030602 2:647796-647818 CCGGCCCTTCCAGGTTCCCAGGA No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030597_925030609 21 Left 925030597 2:647781-647803 CCCGGCCTCACTGCACCGGCCCT No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030604_925030609 1 Left 925030604 2:647801-647823 CCTTCCAGGTTCCCAGGATCTGC No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data
925030599_925030609 16 Left 925030599 2:647786-647808 CCTCACTGCACCGGCCCTTCCAG No data
Right 925030609 2:647825-647847 GCATGCCCGGCCTCACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030609 Original CRISPR GCATGCCCGGCCTCACTGCA TGG Intergenic
No off target data available for this crispr