ID: 925030610

View in Genome Browser
Species Human (GRCh38)
Location 2:647830-647852
Sequence TGCAGCCATGCAGTGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030610_925030614 -1 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030610_925030616 4 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030610_925030617 5 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030617 2:647858-647880 AGCTGCTCCCGGCCTGGGTCGGG No data
925030610_925030613 -6 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data
925030610_925030618 6 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030618 2:647859-647881 GCTGCTCCCGGCCTGGGTCGGGG No data
925030610_925030623 25 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG No data
925030610_925030622 17 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030622 2:647870-647892 CCTGGGTCGGGGTCAGTCGCTGG No data
925030610_925030615 0 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030615 2:647853-647875 TTGTCAGCTGCTCCCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030610 Original CRISPR TGCAGCCATGCAGTGAGGCC GGG (reversed) Intergenic