ID: 925030611

View in Genome Browser
Species Human (GRCh38)
Location 2:647831-647853
Sequence ATGCAGCCATGCAGTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030611_925030618 5 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030618 2:647859-647881 GCTGCTCCCGGCCTGGGTCGGGG No data
925030611_925030623 24 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG No data
925030611_925030616 3 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030611_925030617 4 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030617 2:647858-647880 AGCTGCTCCCGGCCTGGGTCGGG No data
925030611_925030615 -1 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030615 2:647853-647875 TTGTCAGCTGCTCCCGGCCTGGG No data
925030611_925030613 -7 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG No data
925030611_925030622 16 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030622 2:647870-647892 CCTGGGTCGGGGTCAGTCGCTGG No data
925030611_925030614 -2 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030611 Original CRISPR ATGCAGCCATGCAGTGAGGC CGG (reversed) Intergenic
No off target data available for this crispr