ID: 925030614

View in Genome Browser
Species Human (GRCh38)
Location 2:647852-647874
Sequence ATTGTCAGCTGCTCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030612_925030614 -6 Left 925030612 2:647835-647857 CCTCACTGCATGGCTGCATTGTC No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030603_925030614 29 Left 925030603 2:647800-647822 CCCTTCCAGGTTCCCAGGATCTG No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030606_925030614 17 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030611_925030614 -2 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030605_925030614 24 Left 925030605 2:647805-647827 CCAGGTTCCCAGGATCTGCTGCA No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030608_925030614 16 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030610_925030614 -1 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data
925030604_925030614 28 Left 925030604 2:647801-647823 CCTTCCAGGTTCCCAGGATCTGC No data
Right 925030614 2:647852-647874 ATTGTCAGCTGCTCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030614 Original CRISPR ATTGTCAGCTGCTCCCGGCC TGG Intergenic
No off target data available for this crispr