ID: 925030616

View in Genome Browser
Species Human (GRCh38)
Location 2:647857-647879
Sequence CAGCTGCTCCCGGCCTGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030608_925030616 21 Left 925030608 2:647813-647835 CCAGGATCTGCTGCATGCCCGGC No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030612_925030616 -1 Left 925030612 2:647835-647857 CCTCACTGCATGGCTGCATTGTC No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030605_925030616 29 Left 925030605 2:647805-647827 CCAGGTTCCCAGGATCTGCTGCA No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030611_925030616 3 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030610_925030616 4 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data
925030606_925030616 22 Left 925030606 2:647812-647834 CCCAGGATCTGCTGCATGCCCGG No data
Right 925030616 2:647857-647879 CAGCTGCTCCCGGCCTGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030616 Original CRISPR CAGCTGCTCCCGGCCTGGGT CGG Intergenic
No off target data available for this crispr