ID: 925030622

View in Genome Browser
Species Human (GRCh38)
Location 2:647870-647892
Sequence CCTGGGTCGGGGTCAGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030610_925030622 17 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030622 2:647870-647892 CCTGGGTCGGGGTCAGTCGCTGG No data
925030611_925030622 16 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030622 2:647870-647892 CCTGGGTCGGGGTCAGTCGCTGG No data
925030612_925030622 12 Left 925030612 2:647835-647857 CCTCACTGCATGGCTGCATTGTC No data
Right 925030622 2:647870-647892 CCTGGGTCGGGGTCAGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030622 Original CRISPR CCTGGGTCGGGGTCAGTCGC TGG Intergenic
No off target data available for this crispr