ID: 925030623

View in Genome Browser
Species Human (GRCh38)
Location 2:647878-647900
Sequence GGGGTCAGTCGCTGGCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925030612_925030623 20 Left 925030612 2:647835-647857 CCTCACTGCATGGCTGCATTGTC No data
Right 925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG No data
925030611_925030623 24 Left 925030611 2:647831-647853 CCGGCCTCACTGCATGGCTGCAT No data
Right 925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG No data
925030619_925030623 -10 Left 925030619 2:647865-647887 CCCGGCCTGGGTCGGGGTCAGTC No data
Right 925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG No data
925030610_925030623 25 Left 925030610 2:647830-647852 CCCGGCCTCACTGCATGGCTGCA No data
Right 925030623 2:647878-647900 GGGGTCAGTCGCTGGCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925030623 Original CRISPR GGGGTCAGTCGCTGGCACCG AGG Intergenic
No off target data available for this crispr