ID: 925031017

View in Genome Browser
Species Human (GRCh38)
Location 2:649885-649907
Sequence TACCCCACGGTACCCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925031012_925031017 10 Left 925031012 2:649852-649874 CCTCTGCATCTTGATAGCATCAT No data
Right 925031017 2:649885-649907 TACCCCACGGTACCCCAAAGGGG No data
925031011_925031017 20 Left 925031011 2:649842-649864 CCTTCGCTGGCCTCTGCATCTTG No data
Right 925031017 2:649885-649907 TACCCCACGGTACCCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925031017 Original CRISPR TACCCCACGGTACCCCAAAG GGG Intergenic
No off target data available for this crispr