ID: 925031017 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:649885-649907 |
| Sequence | TACCCCACGGTACCCCAAAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925031012_925031017 | 10 | Left | 925031012 | 2:649852-649874 | CCTCTGCATCTTGATAGCATCAT | No data | ||
| Right | 925031017 | 2:649885-649907 | TACCCCACGGTACCCCAAAGGGG | No data | ||||
| 925031011_925031017 | 20 | Left | 925031011 | 2:649842-649864 | CCTTCGCTGGCCTCTGCATCTTG | No data | ||
| Right | 925031017 | 2:649885-649907 | TACCCCACGGTACCCCAAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925031017 | Original CRISPR | TACCCCACGGTACCCCAAAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||