ID: 925031257

View in Genome Browser
Species Human (GRCh38)
Location 2:651421-651443
Sequence CCTCATGCATGGGCTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925031252_925031257 9 Left 925031252 2:651389-651411 CCATTTTCATCCAGAGCGTCTTA No data
Right 925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG No data
925031253_925031257 -1 Left 925031253 2:651399-651421 CCAGAGCGTCTTATTCTATCTTC No data
Right 925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925031257 Original CRISPR CCTCATGCATGGGCTCTGCA TGG Intergenic
No off target data available for this crispr