ID: 925037959

View in Genome Browser
Species Human (GRCh38)
Location 2:706337-706359
Sequence GAGGCCCACCTGAAGGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925037951_925037959 16 Left 925037951 2:706298-706320 CCAACCCAAGAGAGCGCAGTGAC No data
Right 925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG No data
925037953_925037959 11 Left 925037953 2:706303-706325 CCAAGAGAGCGCAGTGACCGCAG No data
Right 925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG No data
925037952_925037959 12 Left 925037952 2:706302-706324 CCCAAGAGAGCGCAGTGACCGCA No data
Right 925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG No data
925037957_925037959 -6 Left 925037957 2:706320-706342 CCGCAGTGAGCATGTGGGAGGCC No data
Right 925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925037959 Original CRISPR GAGGCCCACCTGAAGGTCTG TGG Intergenic
No off target data available for this crispr