ID: 925040693

View in Genome Browser
Species Human (GRCh38)
Location 2:731462-731484
Sequence GGACAACTCCACAAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925040693_925040703 9 Left 925040693 2:731462-731484 CCCCTCCCCTTGTGGAGTTGTCC No data
Right 925040703 2:731494-731516 CAATGTTCCTCTTACACATATGG No data
925040693_925040704 10 Left 925040693 2:731462-731484 CCCCTCCCCTTGTGGAGTTGTCC No data
Right 925040704 2:731495-731517 AATGTTCCTCTTACACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925040693 Original CRISPR GGACAACTCCACAAGGGGAG GGG (reversed) Intergenic
No off target data available for this crispr