ID: 925044748

View in Genome Browser
Species Human (GRCh38)
Location 2:764381-764403
Sequence AGCCTGCAGCTCCCACACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925044747_925044748 6 Left 925044747 2:764352-764374 CCAGACGGACAAGCTTCAGAGAC No data
Right 925044748 2:764381-764403 AGCCTGCAGCTCCCACACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925044748 Original CRISPR AGCCTGCAGCTCCCACACCT CGG Intergenic
No off target data available for this crispr