ID: 925045728

View in Genome Browser
Species Human (GRCh38)
Location 2:771740-771762
Sequence TGTCCACCCAGGAGCCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925045728_925045735 7 Left 925045728 2:771740-771762 CCACACGGGCTCCTGGGTGGACA No data
Right 925045735 2:771770-771792 CGGTGTCGGATTCACCAGTGAGG No data
925045728_925045736 8 Left 925045728 2:771740-771762 CCACACGGGCTCCTGGGTGGACA No data
Right 925045736 2:771771-771793 GGTGTCGGATTCACCAGTGAGGG No data
925045728_925045732 -7 Left 925045728 2:771740-771762 CCACACGGGCTCCTGGGTGGACA No data
Right 925045732 2:771756-771778 GTGGACAGGTGACCCGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925045728 Original CRISPR TGTCCACCCAGGAGCCCGTG TGG (reversed) Intergenic
No off target data available for this crispr