ID: 925057015

View in Genome Browser
Species Human (GRCh38)
Location 2:863870-863892
Sequence GTCCTTCCCTGGTACACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925057004_925057015 -4 Left 925057004 2:863851-863873 CCCACCCTGCCCCCCAGCCGTCC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057005_925057015 -5 Left 925057005 2:863852-863874 CCACCCTGCCCCCCAGCCGTCCT No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057006_925057015 -8 Left 925057006 2:863855-863877 CCCTGCCCCCCAGCCGTCCTTCC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925056998_925057015 21 Left 925056998 2:863826-863848 CCAGGCCTGTGGGTCCAGCCTCA No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057001_925057015 3 Left 925057001 2:863844-863866 CCTCACCCCCACCCTGCCCCCCA No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057000_925057015 7 Left 925057000 2:863840-863862 CCAGCCTCACCCCCACCCTGCCC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925056997_925057015 22 Left 925056997 2:863825-863847 CCCAGGCCTGTGGGTCCAGCCTC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057007_925057015 -9 Left 925057007 2:863856-863878 CCTGCCCCCCAGCCGTCCTTCCC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925056999_925057015 16 Left 925056999 2:863831-863853 CCTGTGGGTCCAGCCTCACCCCC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057003_925057015 -3 Left 925057003 2:863850-863872 CCCCACCCTGCCCCCCAGCCGTC No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data
925057002_925057015 -2 Left 925057002 2:863849-863871 CCCCCACCCTGCCCCCCAGCCGT No data
Right 925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925057015 Original CRISPR GTCCTTCCCTGGTACACAGC TGG Intergenic
No off target data available for this crispr