ID: 925059122

View in Genome Browser
Species Human (GRCh38)
Location 2:877729-877751
Sequence CAGTGAGGGGCTTTCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925059114_925059122 20 Left 925059114 2:877686-877708 CCAGGTCATAGCATCTCTTCTGT No data
Right 925059122 2:877729-877751 CAGTGAGGGGCTTTCACAGATGG No data
925059118_925059122 -8 Left 925059118 2:877714-877736 CCAAGTGGGTTTGTGCAGTGAGG No data
Right 925059122 2:877729-877751 CAGTGAGGGGCTTTCACAGATGG No data
925059113_925059122 21 Left 925059113 2:877685-877707 CCCAGGTCATAGCATCTCTTCTG No data
Right 925059122 2:877729-877751 CAGTGAGGGGCTTTCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925059122 Original CRISPR CAGTGAGGGGCTTTCACAGA TGG Intergenic
No off target data available for this crispr