ID: 925061985

View in Genome Browser
Species Human (GRCh38)
Location 2:898409-898431
Sequence AAATATCTAGAAAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925061981_925061985 19 Left 925061981 2:898367-898389 CCAGAGTTTGCACTTGTGAGCTC No data
Right 925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG No data
925061980_925061985 20 Left 925061980 2:898366-898388 CCCAGAGTTTGCACTTGTGAGCT No data
Right 925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG No data
925061982_925061985 -8 Left 925061982 2:898394-898416 CCAGCTGTTTTGAAAAAATATCT No data
Right 925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925061985 Original CRISPR AAATATCTAGAAAAGGAGCA GGG Intergenic
No off target data available for this crispr