ID: 925062791

View in Genome Browser
Species Human (GRCh38)
Location 2:905797-905819
Sequence TGGCATTATACCCAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925062791_925062798 21 Left 925062791 2:905797-905819 CCCACCAGCTGGGTATAATGCCA No data
Right 925062798 2:905841-905863 CTGGCACATGCTGTAGCTCCTGG No data
925062791_925062800 23 Left 925062791 2:905797-905819 CCCACCAGCTGGGTATAATGCCA No data
Right 925062800 2:905843-905865 GGCACATGCTGTAGCTCCTGGGG No data
925062791_925062799 22 Left 925062791 2:905797-905819 CCCACCAGCTGGGTATAATGCCA No data
Right 925062799 2:905842-905864 TGGCACATGCTGTAGCTCCTGGG No data
925062791_925062795 2 Left 925062791 2:905797-905819 CCCACCAGCTGGGTATAATGCCA No data
Right 925062795 2:905822-905844 GACTCTGCCTGCTCCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925062791 Original CRISPR TGGCATTATACCCAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr