ID: 925064060

View in Genome Browser
Species Human (GRCh38)
Location 2:915298-915320
Sequence ACCCACATGCAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925064053_925064060 24 Left 925064053 2:915251-915273 CCAATGACTGGGCACCACAGGGA No data
Right 925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG No data
925064055_925064060 10 Left 925064055 2:915265-915287 CCACAGGGATGCCGGTGCTGACC No data
Right 925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG No data
925064056_925064060 -1 Left 925064056 2:915276-915298 CCGGTGCTGACCGTGATCCAGAA No data
Right 925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG No data
925064051_925064060 25 Left 925064051 2:915250-915272 CCCAATGACTGGGCACCACAGGG No data
Right 925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG No data
925064049_925064060 28 Left 925064049 2:915247-915269 CCTCCCAATGACTGGGCACCACA No data
Right 925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG No data
925064048_925064060 29 Left 925064048 2:915246-915268 CCCTCCCAATGACTGGGCACCAC No data
Right 925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925064060 Original CRISPR ACCCACATGCAGAAGATGGA AGG Intergenic
No off target data available for this crispr