ID: 925064918

View in Genome Browser
Species Human (GRCh38)
Location 2:922278-922300
Sequence AGCCCGGAAGCACCTTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925064918_925064926 13 Left 925064918 2:922278-922300 CCTCCGGAAGGTGCTTCCGGGCT No data
Right 925064926 2:922314-922336 ACCATGGGCTCCAGCCAGCCTGG No data
925064918_925064924 -3 Left 925064918 2:922278-922300 CCTCCGGAAGGTGCTTCCGGGCT No data
Right 925064924 2:922298-922320 GCTGGTGTGGAGGAAGACCATGG No data
925064918_925064931 24 Left 925064918 2:922278-922300 CCTCCGGAAGGTGCTTCCGGGCT No data
Right 925064931 2:922325-922347 CAGCCAGCCTGGACTCAGGGTGG No data
925064918_925064928 20 Left 925064918 2:922278-922300 CCTCCGGAAGGTGCTTCCGGGCT No data
Right 925064928 2:922321-922343 GCTCCAGCCAGCCTGGACTCAGG No data
925064918_925064929 21 Left 925064918 2:922278-922300 CCTCCGGAAGGTGCTTCCGGGCT No data
Right 925064929 2:922322-922344 CTCCAGCCAGCCTGGACTCAGGG No data
925064918_925064925 -2 Left 925064918 2:922278-922300 CCTCCGGAAGGTGCTTCCGGGCT No data
Right 925064925 2:922299-922321 CTGGTGTGGAGGAAGACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925064918 Original CRISPR AGCCCGGAAGCACCTTCCGG AGG (reversed) Intergenic
No off target data available for this crispr