ID: 925065553

View in Genome Browser
Species Human (GRCh38)
Location 2:926998-927020
Sequence CCCCACACCCTCACAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925065548_925065553 11 Left 925065548 2:926964-926986 CCCGTGAGAAATTCTATGGCGCT No data
Right 925065553 2:926998-927020 CCCCACACCCTCACAAGGATGGG No data
925065549_925065553 10 Left 925065549 2:926965-926987 CCGTGAGAAATTCTATGGCGCTG No data
Right 925065553 2:926998-927020 CCCCACACCCTCACAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925065553 Original CRISPR CCCCACACCCTCACAAGGAT GGG Intergenic
No off target data available for this crispr