ID: 925068812

View in Genome Browser
Species Human (GRCh38)
Location 2:950746-950768
Sequence CCGCTCGCCGCCCTCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 303}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925068799_925068812 15 Left 925068799 2:950708-950730 CCCCGTGGAAGCGCCCCTCTCCC 0: 1
1: 1
2: 0
3: 13
4: 136
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068801_925068812 13 Left 925068801 2:950710-950732 CCGTGGAAGCGCCCCTCTCCCGA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068796_925068812 26 Left 925068796 2:950697-950719 CCAGTTTCCCGCCCCGTGGAAGC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068797_925068812 19 Left 925068797 2:950704-950726 CCCGCCCCGTGGAAGCGCCCCTC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068803_925068812 2 Left 925068803 2:950721-950743 CCCCTCTCCCGACTTCGGCTGAT 0: 1
1: 0
2: 0
3: 5
4: 105
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068798_925068812 18 Left 925068798 2:950705-950727 CCGCCCCGTGGAAGCGCCCCTCT 0: 1
1: 0
2: 1
3: 5
4: 79
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068804_925068812 1 Left 925068804 2:950722-950744 CCCTCTCCCGACTTCGGCTGATC 0: 1
1: 0
2: 1
3: 43
4: 706
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068806_925068812 -5 Left 925068806 2:950728-950750 CCCGACTTCGGCTGATCCCCGCT 0: 1
1: 0
2: 0
3: 12
4: 394
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068800_925068812 14 Left 925068800 2:950709-950731 CCCGTGGAAGCGCCCCTCTCCCG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068807_925068812 -6 Left 925068807 2:950729-950751 CCGACTTCGGCTGATCCCCGCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303
925068805_925068812 0 Left 925068805 2:950723-950745 CCTCTCCCGACTTCGGCTGATCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG 0: 1
1: 0
2: 6
3: 25
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925068812 Original CRISPR CCGCTCGCCGCCCTCCCCGC GGG Intergenic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
901012917 1:6211240-6211262 TAGCTCGCCACCCTCCCAGCAGG + Intronic
901016619 1:6235667-6235689 CGGACCGCCGCCCGCCCCGCCGG + Intronic
901497608 1:9630863-9630885 CCCCTCTCTGCCCTCCCTGCTGG - Intergenic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901845685 1:11980612-11980634 CCACTCTCCGGCCTCGCCGCCGG + Intronic
902820160 1:18938721-18938743 CCTCTGGCCACCCTCCCTGCAGG - Intronic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903649578 1:24914544-24914566 CCGCTCGCCTCCCTGCCCGCTGG - Intronic
905374893 1:37513918-37513940 CAACTCGCTCCCCTCCCCGCAGG + Intronic
905960074 1:42035847-42035869 CCGCCCGCCGCCCGCCACCCCGG - Intronic
907140637 1:52182030-52182052 CCCCTCGCCTCCCTCCCGGACGG - Intronic
912315103 1:108661151-108661173 CCGCGCCTCGGCCTCCCCGCGGG + Intronic
913047925 1:115089499-115089521 CCGCTCCGCCCCCTCCCCGCCGG - Intronic
913129739 1:115828735-115828757 GGGCTCTCCGCCCTCCGCGCGGG + Intergenic
913518254 1:119623260-119623282 GCCCTTGCCGCACTCCCCGCAGG + Exonic
914200011 1:145476121-145476143 CTGCCCGTTGCCCTCCCCGCGGG - Intergenic
915213373 1:154325669-154325691 GCGCTCGGCGCCCGCCCCGGCGG - Intronic
915568311 1:156729074-156729096 TCGCTCCCCGCGCTCCCTGCTGG + Exonic
921029781 1:211327024-211327046 CCGCCTCGCGCCCTCCCCGCCGG - Intronic
921932836 1:220769328-220769350 CCGCTGGCCGCCCTAGCTGCGGG - Intronic
922460276 1:225810241-225810263 CGGCCCGCCGCCCACCCCGGCGG - Intronic
1062774708 10:135504-135526 CCGCGCCCGGCCCTCCCCTCCGG - Intronic
1063930019 10:11018613-11018635 CCGGTCCCCGCCCGCCCCACCGG - Intronic
1064231008 10:13529116-13529138 CCGGCCGCCGCCATCCCCGGGGG + Intergenic
1065099663 10:22321036-22321058 CCCCCCGCCGCCCCCCCAGCGGG - Intronic
1066022716 10:31319355-31319377 CGGCTCGCCCCCCTCACCCCCGG - Intronic
1068866819 10:61903317-61903339 GCGCTCGCCGCGCTCCCGGGAGG + Intronic
1069673890 10:70233431-70233453 GCGCTCCCCGCCCCGCCCGCCGG - Intronic
1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG + Exonic
1070328648 10:75403316-75403338 CCACCTGCCGCCATCCCCGCAGG + Intergenic
1070367331 10:75750255-75750277 CTGCCCACCTCCCTCCCCGCCGG + Intronic
1071086794 10:81875147-81875169 CCGCCCGCCGCCCGCCTCTCGGG + Intergenic
1072009465 10:91290831-91290853 CCACTCTCCGCCCTCCCCAGAGG + Intergenic
1072139039 10:92573795-92573817 CCTCACGCCGCCCGTCCCGCCGG - Intronic
1072421127 10:95291135-95291157 CCGCTCCCCGCCCTGCGCGCCGG + Intergenic
1074121627 10:110497905-110497927 CCGCTCGCCGCCCTAGAAGCCGG - Exonic
1074121679 10:110498075-110498097 CCCCGCGCCGCGCGCCCCGCGGG - Exonic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074853500 10:117456999-117457021 CTGCTCTCAGCCCTCCCAGCAGG - Intergenic
1074921684 10:118020609-118020631 CCGCTCCCCTGCCTCCCTGCTGG + Intronic
1075871297 10:125774086-125774108 CCGCTCCAGGCGCTCCCCGCGGG - Exonic
1076374154 10:129972547-129972569 CTGCTCGCGGCCTTCCCGGCGGG - Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076707057 10:132307877-132307899 CCGCTCCCGGCCCTGCCGGCCGG - Exonic
1076790211 10:132773061-132773083 CCTCCCACCGCCCTCCCCGGTGG + Intronic
1076856115 10:133116315-133116337 CTCCCAGCCGCCCTCCCCGCAGG + Intronic
1076998638 11:311264-311286 CCGCGTCCCGCCCACCCCGCGGG - Intronic
1077000105 11:318495-318517 CCGCGTCCCGCCCACCCCGCGGG + Intergenic
1077160437 11:1110114-1110136 CCTCACTCCGCCCTCCCCCCAGG + Intergenic
1077185353 11:1233314-1233336 CCACTTCCCGCCCTCCCCGAAGG + Intronic
1077210818 11:1370240-1370262 CCGCCCGCTGCCCTCCACGCTGG + Intergenic
1077273619 11:1693346-1693368 CCACTCGCCGGCCGCCCCGCGGG + Intergenic
1077323128 11:1951255-1951277 CTGCACGCCGCCCTCCACCCGGG + Intronic
1077361175 11:2140731-2140753 CCCCACGCCGGCCTCCCCGGCGG + Intronic
1077554164 11:3217983-3218005 CAGCTCGGCGCCCTCCCCCAGGG + Exonic
1077718893 11:4607865-4607887 CCCCTCGACTCCCTTCCCGCTGG - Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1085417811 11:76330869-76330891 CCGCCCGCCTCACTCACCGCTGG + Intergenic
1085520843 11:77138158-77138180 CCCCTCGCCGTCCCGCCCGCGGG + Intronic
1089289217 11:117427719-117427741 GCTCTCTCCTCCCTCCCCGCTGG + Intergenic
1090699118 11:129279074-129279096 CCCCCCGCAGCCTTCCCCGCGGG + Intronic
1202806114 11_KI270721v1_random:6450-6472 CTGCACGCCGCCCTCCACCCGGG + Intergenic
1091406065 12:210341-210363 CAGCTCGCCACCATCCCAGCCGG + Exonic
1092899471 12:13044734-13044756 CCTCTCGCCAGCCTCCCCTCGGG - Intronic
1093077802 12:14775068-14775090 CCGGTCGCCCCCCTCCCCTGGGG - Intronic
1095476284 12:42589926-42589948 CTGCTCGCAGCCCTGCCCCCGGG - Intronic
1096241193 12:49961321-49961343 CCGCTCACCTCCCTCACCGCCGG - Intergenic
1096670884 12:53197663-53197685 CCGCCCGCCGCCCACCCCCTAGG - Exonic
1097088817 12:56488784-56488806 CCGCGCGCCACGCTACCCGCCGG - Intergenic
1101716943 12:107319811-107319833 CCGCTCGCCGCTCCTCCCCCGGG - Exonic
1101772091 12:107761041-107761063 CCGCTCGGCCCCCTCACCCCGGG + Exonic
1102347043 12:112167124-112167146 CCTCTGGCCTCCCTCCCTGCTGG - Intronic
1103719486 12:122965795-122965817 CTGCTCCCCGCCATCCACGCTGG - Intronic
1103722038 12:122980407-122980429 GCGCGCGCCGCCCTCCTCCCCGG - Exonic
1103822815 12:123712297-123712319 CCGCGTCCCGCCCCCCCCGCCGG - Exonic
1104637608 12:130447835-130447857 CCTCTCCCCGCCCTCCATGCAGG - Intronic
1107133329 13:36919687-36919709 CCGACCGCCGCCCCCGCCGCGGG + Intronic
1113456712 13:110454698-110454720 CCCCTCCCTGCACTCCCCGCCGG + Intronic
1113492846 13:110705987-110706009 CCGCTCGCCGCCCGGCCCGCAGG + Exonic
1114422779 14:22598448-22598470 CCACCCCCCGCCCTCCCCGGAGG - Intronic
1114519040 14:23321561-23321583 CCCCTCCCCGGCCTCCCCACCGG - Exonic
1117315153 14:54566183-54566205 CCCCGCGCCGCCCGCCCCGACGG + Intergenic
1119195147 14:72712214-72712236 TCTCTCGATGCCCTCCCCGCAGG - Intronic
1121127311 14:91416838-91416860 CTCCTCGTCCCCCTCCCCGCAGG - Exonic
1121417555 14:93789319-93789341 CTCCCCGCCGCACTCCCCGCAGG + Intergenic
1122108901 14:99481261-99481283 CTCCTCCCCGCCCGCCCCGCGGG - Intronic
1122279184 14:100611069-100611091 CCTCTCCCAGCCCTCTCCGCTGG + Intergenic
1122413917 14:101539501-101539523 CTGCTCTCCCCCATCCCCGCAGG - Intergenic
1122582222 14:102777823-102777845 CCGCGCCCCGCCGTCGCCGCTGG - Intronic
1122715351 14:103693677-103693699 CCCCTCACCGCCCTGCCCGGAGG + Intergenic
1122719930 14:103716162-103716184 GCGCCTCCCGCCCTCCCCGCGGG - Intronic
1122904586 14:104795843-104795865 GCGCGCTCCGCCCTCGCCGCCGG - Intergenic
1125698589 15:41660354-41660376 CCGCTCGGAGCCCGCCGCGCAGG - Intronic
1128067629 15:64774875-64774897 CCGCTCGCCGCCCTCCTCCGAGG - Intronic
1128515392 15:68338862-68338884 CCCCTTGCCGCCCTCCCCTCTGG + Intronic
1129741580 15:77992181-77992203 CAGCTGGCCTCCCTCCCCACTGG + Intronic
1130967104 15:88705592-88705614 CCCCACGCCGCCCCCTCCGCAGG + Intergenic
1131367804 15:91854204-91854226 CCACTCGCCAACCTCCACGCCGG - Intronic
1131674286 15:94655262-94655284 CCCCTTGCTGCCCTCCCCACTGG - Intergenic
1132594279 16:741132-741154 CGGCTCCCCGCCCACCTCGCGGG + Intronic
1132724829 16:1334095-1334117 CCCCGCGCCTCCCTCCCCGGGGG + Intronic
1133053919 16:3135291-3135313 ACGATCGCCGCTCGCCCCGCGGG + Exonic
1134251122 16:12574832-12574854 CCACTGGCCCCCCTCCCCCCAGG - Intergenic
1134373062 16:13643737-13643759 CCTCTCACTGCCCTCCCCACAGG - Intergenic
1134644721 16:15857131-15857153 CCCCTCGCCGCGCCCCCTGCAGG + Intergenic
1135413861 16:22254325-22254347 CCGCTCCCTGCCTTCCCCTCAGG + Intronic
1135557923 16:23452798-23452820 CCGCTCGGGGCCCTGGCCGCGGG - Intronic
1136637996 16:31537778-31537800 CAGCGCGCCGCGATCCCCGCTGG - Intergenic
1136641523 16:31569340-31569362 GCGCCCGCCGCCCTCGTCGCAGG - Intergenic
1137926686 16:52547241-52547263 TGGCGCGCCGCCCGCCCCGCCGG + Intronic
1137988774 16:53131431-53131453 CCCCTGCCCGGCCTCCCCGCGGG - Intronic
1139785044 16:69385864-69385886 GCCCTCCCCGCCCTCCCGGCCGG + Exonic
1140078500 16:71723503-71723525 CCGCGCGCCGCCCGCCTCGCAGG - Intronic
1140267612 16:73433984-73434006 CAGCTCGCCCCCCTCCCAGAAGG - Intergenic
1141593309 16:85082725-85082747 CCCAGGGCCGCCCTCCCCGCCGG - Intronic
1141957776 16:87383890-87383912 CCGCGCCACCCCCTCCCCGCGGG + Intronic
1141989682 16:87602765-87602787 CGGCGCGGCGCCCTCCCCGCGGG + Intronic
1141989690 16:87602780-87602802 CCCCTCGCCGGCAGCCCCGCGGG - Intronic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142253998 16:89005372-89005394 CAGCTCACCTCCTTCCCCGCAGG - Intergenic
1144339975 17:14302692-14302714 CCGCGCGCCGCCCGCCCGCCAGG - Intronic
1147184278 17:38705274-38705296 CCACTCGGCGCCTCCCCCGCCGG + Intergenic
1147261027 17:39209945-39209967 GCGCTCGCCGCCCACCGCTCTGG - Intergenic
1147424829 17:40341575-40341597 CCGCTCGCCAGCCCGCCCGCGGG - Intronic
1147840490 17:43368333-43368355 CCGAGCTCCGTCCTCCCCGCAGG + Intergenic
1147896551 17:43755316-43755338 CCGCCCGCGCCCCTCCCCACCGG - Exonic
1147969125 17:44210399-44210421 CCGTTCCTCGCGCTCCCCGCCGG + Exonic
1148437421 17:47694689-47694711 CCCCTCTGCGCCCACCCCGCTGG - Intronic
1148664175 17:49362160-49362182 CCCCGCGCTGCCCGCCCCGCCGG - Intronic
1149923177 17:60677900-60677922 CCTCTCACCGGCCGCCCCGCCGG - Exonic
1150284358 17:63946865-63946887 CCCCTAGCTGTCCTCCCCGCAGG - Intronic
1152233329 17:79125716-79125738 CCACGCGGCGCCCTTCCCGCAGG - Intronic
1152562293 17:81084676-81084698 CCCCTCTCCGCCCTCCCTTCTGG + Intronic
1152744109 17:82031393-82031415 GCGCGCGGAGCCCTCCCCGCCGG + Intergenic
1152750437 17:82060093-82060115 CTGCCCGCTGCCCTCCCCTCAGG - Exonic
1153238744 18:3012813-3012835 CGGCTCCCCGCGCACCCCGCCGG + Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1154304041 18:13217954-13217976 CGGCGCGCCGCGCTCCCCGCCGG + Intronic
1158434821 18:57428312-57428334 CCGCTCTCCGCGCTGCCCACTGG - Intergenic
1160453123 18:78979119-78979141 GCGCTCGCTGCCCACTCCGCTGG + Intergenic
1160453357 18:78979813-78979835 CCGCGCGGCGCCGTCTCCGCCGG - Intergenic
1160453461 18:78980201-78980223 CCGCCCCGCGCCGTCCCCGCCGG + Intergenic
1160706526 19:532534-532556 GCCCTCCCCGCCCTCCCCGGAGG + Intronic
1160725546 19:616474-616496 ACCCTCGCCGACCGCCCCGCGGG + Exonic
1160908941 19:1465992-1466014 CCTCTCGCCGCCCGCCCTCCGGG - Exonic
1160919689 19:1513685-1513707 CCGCCTCCCGCCCTCCCTGCCGG + Intergenic
1160952850 19:1675868-1675890 CCTCACGGCCCCCTCCCCGCCGG + Intergenic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161394533 19:4038203-4038225 CCGCCCCGCGCCCTCCCCTCCGG + Exonic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1163440366 19:17319735-17319757 CCGCCCGCCCGCCTCCCTGCCGG + Exonic
1163488989 19:17606003-17606025 CCGCCCAGCGCCCTCCGCGCAGG + Exonic
1163509652 19:17727178-17727200 CGGCTCTCCGGCCTCCCAGCTGG + Exonic
1163517801 19:17775365-17775387 CCGCCCCCCGCCCTGCCCCCAGG - Intronic
1163582986 19:18149342-18149364 CAGCATCCCGCCCTCCCCGCTGG + Exonic
1163637628 19:18444736-18444758 GCCCTAGCCGCCCTCCCCGATGG - Exonic
1164648031 19:29873406-29873428 CCGCTCCGCGCCCTCCCCGCGGG + Intergenic
1165495830 19:36151613-36151635 CGGCTCGGCGCGCTCCCGGCTGG + Intronic
1165495871 19:36151755-36151777 CCGCCCACCTCCCACCCCGCAGG - Exonic
1165894617 19:39134005-39134027 CCCCTCCCTGCCCTCCCCACAGG + Intronic
1166046553 19:40233825-40233847 ACGCTCGCTGCCATCACCGCTGG - Exonic
1167575437 19:50315484-50315506 CCGTTCCCTGCCCTCTCCGCTGG - Intronic
1167638237 19:50667354-50667376 CCCCTCCCCGACCTCCCCGAGGG - Exonic
1167703618 19:51065605-51065627 CCGCTCCCCGCCCCCGCCCCAGG + Intergenic
1167704977 19:51076577-51076599 CTGCTCCCCTCCCTCCCCACAGG - Intergenic
1168689488 19:58368283-58368305 CCGCTCGCTGTAGTCCCCGCAGG + Exonic
925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG + Intergenic
925927664 2:8681860-8681882 TCGCGCCCCGCCCACCCCGCGGG + Exonic
927558219 2:24050343-24050365 CCGCTCACAGCCCGGCCCGCAGG - Intronic
927702639 2:25277516-25277538 CCACTCCCCGCCCTAGCCGCAGG - Intronic
927881470 2:26692754-26692776 GCGCTCGCCGCTCTCCGCGCCGG - Exonic
931286530 2:60836494-60836516 CCAGTAGCAGCCCTCCCCGCTGG + Intergenic
931694232 2:64859896-64859918 CCTCTCGGCGCCGCCCCCGCTGG - Intergenic
932434414 2:71694796-71694818 CCCATCGCGGCCCTCCCCTCTGG - Intergenic
934656012 2:96117043-96117065 CCGCTCCCCCACCTCTCCGCAGG - Intergenic
935301473 2:101697409-101697431 CCGCTGCCCGCGCTGCCCGCCGG + Intronic
935359875 2:102238149-102238171 CCGCTCGCAGCCCTACCTCCAGG - Intronic
935904966 2:107829680-107829702 CCGCCCGCCGCGGTCCCCCCAGG - Intronic
936126743 2:109794752-109794774 CCGCCCGCCGCGGTCCCCCCAGG - Intronic
936217954 2:110576734-110576756 CCGCCCGCCGCGGTCCCCCCAGG + Intronic
936427291 2:112432808-112432830 CCGCCCGCCGCGGTCCCCCCAGG + Intronic
936526764 2:113246715-113246737 CCGCAGGCCGCCTTCCCCGCAGG - Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
938034836 2:128027501-128027523 CCGCTCCCCGCCCCCTTCGCCGG - Intronic
938338896 2:130522730-130522752 CGGCCCGTGGCCCTCCCCGCAGG - Intronic
938350942 2:130598020-130598042 CGGCCCGTGGCCCTCCCCGCAGG + Intronic
940640852 2:156342709-156342731 CCGCGAACCGCGCTCCCCGCAGG - Intergenic
942034752 2:171999918-171999940 TCGCTCGCCGCCCCGCCCGCTGG - Exonic
942226533 2:173821679-173821701 CCGCTTGCCTCCCTCTCCCCTGG + Intergenic
942450791 2:176106998-176107020 CCGCTGGCCGCTGTCACCGCTGG - Intronic
942947152 2:181683724-181683746 CCTCCCGCCCCCCTTCCCGCGGG - Intergenic
945251631 2:207769716-207769738 CCGCTCGCCTCCTCCCCTGCAGG + Intergenic
946019767 2:216633265-216633287 CCGCTCGCCCACCTCCGCGTTGG - Intronic
946238680 2:218340927-218340949 CCCCTCTCCTCCCTCCCTGCTGG - Intronic
947565513 2:231190628-231190650 CCTCTCGCCGTCCTGACCGCTGG + Intergenic
948115857 2:235494068-235494090 CCGCCCGCCGCCTGCCCGGCCGG - Intronic
1168795893 20:610060-610082 CCGCCCGCCGCCCGCCCCCGGGG + Exonic
1169068587 20:2708092-2708114 CCCCTCGCCGCCCTTGCCCCTGG + Intronic
1174054001 20:47785690-47785712 CTGCCCGCCGGCCTCCACGCAGG + Intronic
1175628771 20:60513294-60513316 CCGCTCGACACCCTGCCCCCTGG + Intergenic
1175974393 20:62703134-62703156 ACGCCCTCCTCCCTCCCCGCTGG + Intergenic
1176056737 20:63152868-63152890 CCCCTCGCCACCCTACCCCCGGG - Intergenic
1176135633 20:63520929-63520951 CCCCTCGCCCCCCGCCCCTCGGG - Intronic
1176555770 21:8253433-8253455 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1176574707 21:8436467-8436489 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1176611321 21:8987760-8987782 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1176733308 21:10521277-10521299 CCCCTCCCCCCCCGCCCCGCCGG + Intergenic
1178981411 21:37267900-37267922 CCGCACCCTGCCCTTCCCGCGGG + Intronic
1179470583 21:41607403-41607425 CCCCTAGCCTCTCTCCCCGCTGG - Intergenic
1179833548 21:44012843-44012865 CCGCTCCTCGCCCTCGACGCCGG - Intronic
1180083271 21:45496478-45496500 CAGCTCTCTGCCCTCCCCACAGG + Exonic
1180101637 21:45590451-45590473 CGCGTCCCCGCCCTCCCCGCCGG - Intergenic
1180703564 22:17794914-17794936 CCACACACTGCCCTCCCCGCGGG - Intronic
1182222944 22:28773009-28773031 CCGCGCGCCGCACTCCCAGCGGG - Exonic
1183299502 22:37051956-37051978 CCGCTCGCCGCCCACCCCGGGGG - Intronic
1183632341 22:39040981-39041003 CCGCTGCCCGCTCTACCCGCTGG + Intronic
1184384261 22:44165410-44165432 CAGCTCGCCACACTCCCTGCTGG - Intronic
1184589280 22:45470847-45470869 CCCCCCTCCCCCCTCCCCGCTGG + Intergenic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1184796950 22:46738229-46738251 CCGCCCGCCGCCCGCCGCCCGGG - Exonic
1185095507 22:48804069-48804091 CTTCTCGCCGCCCGCCCTGCTGG + Intronic
1185333441 22:50261616-50261638 CCGCTCGCCCGCCCGCCCGCCGG + Exonic
1185333456 22:50261653-50261675 CCGCTCCCGGCCCTTCCCTCAGG + Exonic
1185417948 22:50720344-50720366 CTTCTCGCCGCCGCCCCCGCCGG + Intergenic
1203252755 22_KI270733v1_random:125518-125540 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1203260811 22_KI270733v1_random:170604-170626 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
949858626 3:8485204-8485226 CCTCTCCCAGCCCACCCCGCCGG + Intergenic
950729852 3:14947825-14947847 CCGCGCCCTGCCCTCCGCGCCGG + Intronic
951630655 3:24716520-24716542 CCCCCCGCCCCCCTCCCCACTGG - Intergenic
952816561 3:37452323-37452345 GCGCTCGGCGCCCTGCTCGCCGG + Exonic
954313217 3:49786293-49786315 CCCGCCACCGCCCTCCCCGCGGG + Intronic
954425219 3:50439615-50439637 CCACTGGCTGCCCTCCCTGCAGG - Intronic
956195608 3:66651097-66651119 CCCCCCCCCGCCATCCCCGCTGG - Intergenic
956675043 3:71725333-71725355 CCGGCCGCCGCGCCCCCCGCCGG - Exonic
956755100 3:72378021-72378043 CCCCTCCCAGCCCTCCCCACCGG + Exonic
958814595 3:98901648-98901670 CCGCTCGCCGCGCTCACCCGCGG + Exonic
960955205 3:123026810-123026832 CCCCTCTCCACCCTCCCAGCCGG + Intronic
961081958 3:124034389-124034411 GCGCCCACCGCCCTCCCAGCTGG - Intergenic
961453702 3:127014130-127014152 CCGCCCACTGCCCACCCCGCCGG - Intronic
963038369 3:141051375-141051397 CCGCTCCCCGCCTTCCCGGCCGG - Intergenic
967997381 3:195176986-195177008 CCACATGCCGCCCTCCTCGCTGG + Intronic
968514376 4:1010151-1010173 CCACCTGCCGCCCTCCCGGCCGG - Exonic
968562223 4:1290068-1290090 GCTCCCGCCGCCCTCGCCGCTGG - Intronic
969413182 4:7042885-7042907 CCCGTCTCCGCCTTCCCCGCCGG + Exonic
970636979 4:18021185-18021207 CCTCCGGCCGCCCTGCCCGCCGG + Intronic
971405630 4:26319487-26319509 CCGCCCGCCGCCCGCCTCCCGGG + Intronic
972671109 4:41214649-41214671 CCATTCGGCCCCCTCCCCGCCGG - Intronic
973619470 4:52712561-52712583 CGGCCGGGCGCCCTCCCCGCGGG - Intergenic
978154441 4:105473603-105473625 CTGCCAGCCGCCCTCCCCGAGGG - Intronic
978189405 4:105895384-105895406 CCCCTGGCGCCCCTCCCCGCGGG + Intronic
979547150 4:121951512-121951534 GCGCTCGGCGCCCTCGCAGCGGG - Exonic
980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG + Intronic
985504515 5:271497-271519 CCAGACCCCGCCCTCCCCGCAGG + Intergenic
987340671 5:16936356-16936378 CCGCTCGCGGCCCCGCCCCCAGG + Intergenic
989178853 5:38556635-38556657 CCGCGCGCCGCAGTCCCGGCTGG - Intronic
997965480 5:138352880-138352902 CCGCTCGCCGCTGCCGCCGCGGG - Exonic
998130737 5:139649937-139649959 GCGCACCCCGCGCTCCCCGCCGG - Intronic
998463581 5:142326034-142326056 CCTCTCACCGGCCTCCCCTCCGG + Intronic
998467516 5:142357371-142357393 CCGCGCGCCGCCCTTCTCTCCGG + Intergenic
1000358260 5:160421934-160421956 CAGCCCGCCTCCTTCCCCGCCGG - Exonic
1001506435 5:172283900-172283922 CCGCGCGCCGCCCTCGCCTTCGG + Exonic
1002926594 6:1609096-1609118 CTTCTCGCCCCCCTCCCCGGGGG - Intergenic
1003324897 6:5084480-5084502 CCCCTCTCCGCCCTCCCTGCGGG + Intergenic
1003995825 6:11538243-11538265 GCGCCCGCCGCCCTCTCCTCGGG - Intergenic
1005838340 6:29724109-29724131 CCCCTCCCCGCCCAACCCGCGGG - Intronic
1006220401 6:32484604-32484626 ACCCTCCCGGCCCTCCCCGCAGG + Intergenic
1007347133 6:41239702-41239724 CCGCTCGCCTGCGCCCCCGCGGG - Intergenic
1007383050 6:41503000-41503022 CAGCTCACCGCCTTCTCCGCGGG - Intergenic
1007844054 6:44739368-44739390 CCGGCCGCCACCCTGCCCGCGGG - Intergenic
1008379197 6:50823433-50823455 CAGCTCGCGGCTCTCCCAGCTGG + Exonic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1016329888 6:142945206-142945228 CCGCGCGGCCCCCTCCCCCCAGG + Intergenic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1018046372 6:159969448-159969470 GCGCTCCCCGCCCCCCACGCCGG - Intronic
1018945517 6:168345212-168345234 CCGCACGCCCCTCTCCCCGCAGG - Intergenic
1019177057 6:170165359-170165381 ATGGTCGCCGCCCTCCCAGCAGG + Intergenic
1019379160 7:712306-712328 CCGCGCGCCCCACTCCCGGCGGG + Intronic
1020001599 7:4759289-4759311 CCGCTCTCCGCCCTCCGTGCAGG + Exonic
1020049462 7:5072355-5072377 CCGACAGCCGCCCTGCCCGCAGG + Exonic
1020273003 7:6608000-6608022 CCTCACGCCGCGCTCCCCCCGGG + Exonic
1022207808 7:28180357-28180379 CCTGCCGCCTCCCTCCCCGCCGG + Intronic
1023067165 7:36389686-36389708 CCCCTCCCAGCCCTCGCCGCGGG - Intronic
1023725314 7:43137217-43137239 CCTCTCCCCTCCCTCCCAGCAGG + Intronic
1023764539 7:43498341-43498363 CCACTGGCCTCCCTCCCTGCGGG - Intronic
1024216657 7:47254383-47254405 CCGCTCACCCCCTCCCCCGCAGG + Intergenic
1027378358 7:77576927-77576949 TTGCTCCCCGCCCTCCCAGCTGG - Intronic
1029460946 7:100693799-100693821 CCGCTCGCCCCCCTCGCACCTGG - Intergenic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1033656890 7:143381007-143381029 CCCCTCCCCGCCCGACCCGCGGG - Intergenic
1034439737 7:151080650-151080672 CCTCCCGCAGCCCTCCCCGCAGG + Intronic
1034560600 7:151877252-151877274 GCGCTCGCGGCCCTGCGCGCCGG + Intergenic
1035662597 8:1359252-1359274 CTCCTCGCTGCCCTCCCTGCTGG + Intergenic
1037768980 8:21788055-21788077 CCGCTCGCCCCCCGCCTCCCCGG + Intronic
1037783251 8:21885825-21885847 CCACTCGCCGCTCACTCCGCAGG + Intergenic
1038575812 8:28702182-28702204 TCGCCTGCTGCCCTCCCCGCTGG + Intronic
1039967294 8:42292673-42292695 CCTCTCTCCGCCCTCCTCGGAGG + Intronic
1040495399 8:47961026-47961048 CCGCGCCACGCCCTCCCCGCCGG - Exonic
1041167255 8:55102312-55102334 CCGCCCGCCGCCCGCCGGGCTGG - Intergenic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1042962705 8:74320901-74320923 CCGCTCACCTCCGTCCCCGTAGG + Exonic
1043502931 8:80874231-80874253 CCGGCCGCCGGCGTCCCCGCCGG - Intronic
1043542584 8:81280431-81280453 CCGGTCCCCGCCCCGCCCGCCGG - Exonic
1044229426 8:89757662-89757684 CCGCTCGCGGCCCTCCCGCCTGG - Intergenic
1045510866 8:102810889-102810911 CCGCTCGCCGAGCGCCCGGCAGG - Intergenic
1049090717 8:140511682-140511704 CCCCTCGCGCCCCGCCCCGCCGG + Intronic
1049452405 8:142669383-142669405 CCGCTAGGAGCCCTCCACGCTGG + Intronic
1049660136 8:143816129-143816151 GGGCTCGCAGCCGTCCCCGCAGG - Intergenic
1049788701 8:144463202-144463224 GCTCTCGCCCCCTTCCCCGCAGG + Intronic
1049802159 8:144522866-144522888 CCTCCGGCCGCCCGCCCCGCCGG - Exonic
1050459400 9:5864515-5864537 CCGCTCGCCCCCCTCCCCACGGG - Intergenic
1051170545 9:14315286-14315308 CGGTTTGCCGCCCTCCCCGGGGG + Intronic
1057772835 9:97983407-97983429 CCGCACGCCGCCCGCCACCCAGG + Exonic
1057781798 9:98056585-98056607 CGCCCCGCCGCCCTTCCCGCGGG + Intergenic
1058912560 9:109534262-109534284 CCGCCCCCCGCCCTCAGCGCCGG - Intergenic
1059208280 9:112486834-112486856 CCGCCCGCCGCGCTCCGAGCCGG + Intronic
1060087205 9:120713974-120713996 CCCCTCGCCGACCACCCCTCCGG - Exonic
1060151199 9:121289424-121289446 CCGCTCCCCTCCCTGCCTGCTGG + Intronic
1060485893 9:124045857-124045879 CCGCCCCCCGCCCACCGCGCGGG - Intergenic
1060527513 9:124328799-124328821 CCCCTCCCCGCCAGCCCCGCTGG - Intronic
1061986502 9:134133060-134133082 CTGCTGGCCACCCTCCCCGCTGG - Intergenic
1062001161 9:134216397-134216419 CCCCTCGAGGCCCGCCCCGCTGG - Intergenic
1062087305 9:134655364-134655386 CCGCCCTCCACCCTCCCGGCTGG - Intronic
1062160088 9:135075267-135075289 CCGGCCGCCGCCCTCCTCCCCGG + Intergenic
1062452418 9:136621207-136621229 CTGCCGGCCGCCCTCTCCGCAGG + Intergenic
1062462307 9:136667033-136667055 CCCCCAGCCACCCTCCCCGCTGG + Intronic
1062569950 9:137180412-137180434 CCGCTGCCCGGCCGCCCCGCAGG - Intronic
1062653665 9:137590913-137590935 CCGCTCCCCGCCCGCCCAGAGGG - Intergenic
1062696535 9:137878735-137878757 GCGCTCGGCCCCCTCCCCTCGGG + Intronic
1203469158 Un_GL000220v1:108669-108691 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1203476979 Un_GL000220v1:152641-152663 CGGCGCTCCGCCCGCCCCGCGGG - Intergenic
1192473709 X:71420886-71420908 CCCCTCCCCGGCCTCCCCACCGG + Intronic
1198321361 X:135521416-135521438 CCCCTCGCCGCCCGCCCCGCCGG - Intronic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic