ID: 925068852

View in Genome Browser
Species Human (GRCh38)
Location 2:950852-950874
Sequence CTCGGGCTCCACCGGGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 138}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925068852_925068858 -7 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068858 2:950868-950890 GCCCGAGCCGGAGCCGGCAGAGG 0: 1
1: 0
2: 1
3: 26
4: 345
925068852_925068864 0 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068864 2:950875-950897 CCGGAGCCGGCAGAGGGGCGCGG 0: 1
1: 0
2: 1
3: 42
4: 355
925068852_925068873 30 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068873 2:950905-950927 CGCGGCGCCTGGCGGGGCCCTGG 0: 1
1: 0
2: 6
3: 45
4: 534
925068852_925068862 -5 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068862 2:950870-950892 CCGAGCCGGAGCCGGCAGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 168
925068852_925068872 24 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068872 2:950899-950921 CGCGGACGCGGCGCCTGGCGGGG 0: 1
1: 0
2: 2
3: 73
4: 5962
925068852_925068860 -6 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068860 2:950869-950891 CCCGAGCCGGAGCCGGCAGAGGG 0: 1
1: 0
2: 2
3: 9
4: 136
925068852_925068871 23 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068871 2:950898-950920 GCGCGGACGCGGCGCCTGGCGGG 0: 1
1: 0
2: 2
3: 46
4: 5184
925068852_925068865 1 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068865 2:950876-950898 CGGAGCCGGCAGAGGGGCGCGGG 0: 1
1: 0
2: 3
3: 29
4: 323
925068852_925068870 22 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068870 2:950897-950919 GGCGCGGACGCGGCGCCTGGCGG 0: 1
1: 0
2: 0
3: 40
4: 307
925068852_925068868 12 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068868 2:950887-950909 GAGGGGCGCGGGCGCGGACGCGG 0: 1
1: 1
2: 10
3: 81
4: 732
925068852_925068869 19 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068869 2:950894-950916 GCGGGCGCGGACGCGGCGCCTGG 0: 1
1: 0
2: 9
3: 77
4: 537
925068852_925068867 6 Left 925068852 2:950852-950874 CCTGCGCCCCGGTGGAGCCCGAG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 925068867 2:950881-950903 CCGGCAGAGGGGCGCGGGCGCGG 0: 1
1: 0
2: 8
3: 52
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925068852 Original CRISPR CTCGGGCTCCACCGGGGCGC AGG (reversed) Exonic
900166632 1:1246620-1246642 CTCGTGCTCCTCGGGGGCGTCGG - Exonic
900417545 1:2542058-2542080 CTCGGCCTCCACCTGGCAGCTGG - Intergenic
902770589 1:18643337-18643359 CTTGGTCTCCACCGGAGCTCGGG - Intronic
903435300 1:23344519-23344541 CTGGGGCGCCTCCGGGGCGGGGG + Intergenic
909475352 1:76075200-76075222 CTCAGGCTCCACAGAGCCGCGGG - Intronic
912775143 1:112502138-112502160 CCCGGGCTACTCCGGCGCGCAGG + Intronic
915343490 1:155188666-155188688 CCCGGGCTCCACCCCGGCCCCGG - Intronic
916939067 1:169661462-169661484 CTCGGGCTGCACAGGAGCCCAGG - Intergenic
916940104 1:169668300-169668322 CTCGGGCTGCACAGGAGCCCAGG - Intronic
922199994 1:223393529-223393551 CTCGTTCTCCGCCGGGCCGCGGG - Exonic
1065214902 10:23439582-23439604 CTCGGGCTCGGGCGCGGCGCCGG - Exonic
1066657898 10:37712280-37712302 CTCGGCCTCCACCGTGGGCCTGG + Intergenic
1068560958 10:58513453-58513475 CTCCGGCTCCGCGGGGGAGCGGG - Intronic
1072562157 10:96586629-96586651 GTGGGGCACCACCGGGCCGCCGG + Intronic
1072976730 10:100065359-100065381 CTCGGGTTCCACCTGGGAGGAGG + Exonic
1075796480 10:125123671-125123693 CTCCGGCTCCCCAGGGGCCCCGG + Intronic
1076646402 10:131957763-131957785 CTCCATCTCCACAGGGGCGCGGG - Intronic
1076683745 10:132187527-132187549 CCCGGGCTGGTCCGGGGCGCGGG + Intronic
1076841566 10:133048502-133048524 CCCGGCCTCCACAGGGGCCCAGG + Intergenic
1077635994 11:3841363-3841385 CTCGCACTCCCCCGGGGCTCAGG - Intergenic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1083890207 11:65592199-65592221 CTCGTCCTCCTCCAGGGCGCTGG - Exonic
1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG + Intergenic
1089466362 11:118689046-118689068 CTCGGGCTGCACAGGAGCCCAGG + Intergenic
1089563219 11:119356413-119356435 CGCCGGCTCCTCCGCGGCGCGGG + Exonic
1089622395 11:119729301-119729323 CTCGGGCTCCGACCGGGCCCCGG - Intergenic
1092206887 12:6620270-6620292 CTCGGCCACCAACGGGACGCGGG - Exonic
1093736451 12:22625456-22625478 CTTGGGCACCTCCGGGGAGCCGG - Exonic
1097237015 12:57547089-57547111 CCCCGGCTCCACCGAGGCCCGGG - Exonic
1102519809 12:113471262-113471284 CGCGCGCTCCACTGGGGCGCTGG - Intronic
1103562570 12:121800216-121800238 CCCGGGATCCCCCGAGGCGCGGG - Intronic
1104983225 12:132583078-132583100 CTCGCGCTCCGCGGGGGCCCCGG - Exonic
1111950749 13:94707395-94707417 CTCGGCCTCCGCTGGGCCGCGGG + Intergenic
1112771837 13:102800637-102800659 CCCGGCCTCCCCAGGGGCGCGGG + Intronic
1113906314 13:113820873-113820895 GGCGGGCTCCACGGGGGGGCAGG + Exonic
1117298079 14:54396989-54397011 CGCGGGCTCGGCCGGGGCACCGG + Exonic
1117795347 14:59388173-59388195 CTCTGGATCCACCTGGGAGCAGG - Intergenic
1118725782 14:68628297-68628319 CTCGGGCCGCCCCGGGGCGCGGG + Intronic
1119685146 14:76625351-76625373 CTGGGGATCCACCGTGGTGCTGG - Intergenic
1121803883 14:96797551-96797573 CTGTGGGTCCACCGGGGTGCGGG + Intronic
1121803939 14:96797771-96797793 CTCGGGCCTCACCGGGAAGCCGG + Intronic
1125721237 15:41846092-41846114 CTGGGGCTGCACCAGGGGGCGGG + Intronic
1128423959 15:67521143-67521165 CTCGGGCACCCGCGCGGCGCCGG + Exonic
1133102611 16:3488343-3488365 CTCGGGCTCCACCCCTGAGCAGG - Intergenic
1136023610 16:27455777-27455799 CTTGGGTTCCACCGGTGCCCTGG - Intergenic
1139470322 16:67174765-67174787 CTCTGGCTCCTCCGGGGTCCCGG - Exonic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1144494640 17:15738528-15738550 CTCAGGCACCACAGGTGCGCTGG + Intronic
1144905616 17:18638148-18638170 CTCAGGCACCACAGGTGCGCTGG - Intronic
1146654751 17:34628698-34628720 CTCGGGCTCACCTGGGGGGCAGG - Exonic
1147188303 17:38724796-38724818 CTAGGGCTCCAGCGGGCAGCAGG - Exonic
1148581686 17:48747959-48747981 AGCGGGCTCCACCGGGTCCCAGG + Intergenic
1148786858 17:50149810-50149832 CCCGGGCTCCCCAGGGCCGCAGG - Exonic
1150266871 17:63837736-63837758 CTGGGGCTCCAGCAGGGCTCTGG - Intronic
1152354713 17:79801146-79801168 GACGGGCCCCAGCGGGGCGCTGG + Intronic
1152376191 17:79920082-79920104 CTCGGGGCTCCCCGGGGCGCAGG - Intergenic
1152737452 17:82004416-82004438 CTGGGGGTCCACCGGGGGCCTGG + Intronic
1155654249 18:28176782-28176804 ATCGGGCTCCGTCCGGGCGCCGG - Intronic
1157867118 18:51197006-51197028 CTCGGCCGCCTCCGGGGCCCCGG + Exonic
1161438876 19:4279548-4279570 GGCGGGCTCCCCAGGGGCGCGGG - Exonic
1163861379 19:19744692-19744714 CTCGGGAGCCACCTGGGCTCCGG - Intergenic
1164394525 19:27851411-27851433 CACGGGCTGCAGCGGGGAGCTGG + Intergenic
1166294614 19:41883012-41883034 CTCGGGCGCGGCCGGGGCGGGGG + Intergenic
1166851178 19:45762066-45762088 CTTGGGCTTCACAGGGGCCCTGG - Exonic
1166852647 19:45767889-45767911 CTCAGGCGCCCGCGGGGCGCGGG - Intronic
1166895669 19:46020541-46020563 CTCGGGGTCCACTGGGGGACAGG + Intronic
925068852 2:950852-950874 CTCGGGCTCCACCGGGGCGCAGG - Exonic
929511464 2:42568718-42568740 CTCGGGCTCCGCGGGCGGGCGGG + Intronic
929539620 2:42810067-42810089 ATCGGGCCTCCCCGGGGCGCGGG + Intergenic
934561829 2:95317504-95317526 CTCTGGCTGCCCCGGGGCTCTGG + Intronic
935337843 2:102033728-102033750 CTCGGCCTCCACCAGGGGTCTGG - Intergenic
935622924 2:105144377-105144399 CTCGGGGCCCGCCGGGCCGCGGG + Intergenic
935806243 2:106750643-106750665 CTCAGGCTCCACCCAGGCTCTGG + Intergenic
936058711 2:109280502-109280524 CTGGGGCTCCACTGGGGCCATGG + Intronic
939953357 2:148502425-148502447 CTCGGGCTCCACCTGAGTGAAGG - Exonic
948926523 2:241102212-241102234 CGCGGGCTTCTCCGGGTCGCAGG - Intronic
1171307485 20:24118703-24118725 CTCTGGCTCCACTGGGCAGCAGG - Intergenic
1172999583 20:39095990-39096012 CTCTGCCTCCACAGGGGCCCTGG - Intergenic
1176090270 20:63315482-63315504 CTCGGGCTCTTCCTGGGCGTGGG + Intronic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1180180859 21:46118170-46118192 CTGGGGCTCCACCTGGGAGGAGG - Intronic
1180960708 22:19761109-19761131 CTCGGGCTCGGCGGCGGCGCTGG - Exonic
1181127022 22:20708541-20708563 CCCGGGCGCCACCTGGGGGCAGG + Intronic
1181240356 22:21473844-21473866 CCCGGGCGCCACCTGGGGGCAGG + Intergenic
1181312562 22:21953003-21953025 CTGCGGCTCCACCTGGGCTCCGG + Intergenic
1183451530 22:37898630-37898652 CTGGGGCTCCACGAGGGGGCAGG - Intergenic
1184337486 22:43862335-43862357 CTCGAACTCCCCCGGGGTGCTGG + Exonic
1184568964 22:45310218-45310240 CTCGGGGTCCCCAGGGGCTCCGG - Intronic
1185335774 22:50270340-50270362 CTCGGGCTCGGCTCGGGCGCGGG - Exonic
1185395105 22:50582784-50582806 CGCGGGCTCGACCGGGCCCCAGG + Exonic
952316579 3:32238013-32238035 CCCAGGCTCCACCGGTCCGCGGG + Intergenic
954226164 3:49182735-49182757 CTCGGGCTGCACAGGAGCCCAGG + Intronic
962971134 3:140403168-140403190 TTCAGGCTCCACAGGGGCTCTGG + Intronic
963365108 3:144324130-144324152 CTCTGGACCCACCGGGGAGCTGG + Intergenic
963602910 3:147392791-147392813 CTCCGGCACCACCTGGTCGCTGG + Intronic
967527698 3:190513960-190513982 CTCGCGATCCACCGGCGCTCTGG - Intergenic
967684899 3:192408272-192408294 CTTGCGCTCCGCCGGGGCGAGGG + Exonic
968230657 3:197003056-197003078 CTCGGGCGACACCGCGGGGCGGG + Exonic
968965169 4:3766009-3766031 CTCCGGCTGCTCCCGGGCGCGGG - Intergenic
969378917 4:6782193-6782215 CGGGGGCTGCACCGGGCCGCGGG + Intronic
969506571 4:7591706-7591728 CCCGGGCTCTACGGGGGCGATGG - Intronic
970456214 4:16226532-16226554 CTCGGGCTCCGGCGAGGGGCGGG - Exonic
981487460 4:145302207-145302229 CTGGGGCTCCACTGGGTCCCTGG - Intergenic
983923512 4:173371527-173371549 CTGGGGCCCCACCGAGGGGCGGG - Intronic
984095478 4:175428001-175428023 CGCGGGCTCCAGGTGGGCGCGGG + Intergenic
985784586 5:1887121-1887143 CGCGCGCTCCAGCGGGGAGCCGG + Exonic
987421104 5:17720739-17720761 CTCAGGCTCCACTGTGGTGCTGG + Intergenic
988949276 5:36241448-36241470 CCCGGGCTCGGCCGGGGCTCTGG - Intronic
990176056 5:53109775-53109797 CGCGGGCTCACCCGGAGCGCAGG + Intronic
997654236 5:135543852-135543874 CTCTCGCTCCACGCGGGCGCGGG - Intergenic
1002102094 5:176862684-176862706 CTCGGGCTCCACCAGGAAGTGGG - Exonic
1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG + Intronic
1007573751 6:42911570-42911592 CTCCGGCTCCCGCGGGGCTCAGG - Intergenic
1010033040 6:71289317-71289339 CCCGGGCTCCACCGGGAGACAGG - Intronic
1011084566 6:83524467-83524489 GTCGGGCTCCACCGGTTCGGGGG + Exonic
1012401175 6:98843765-98843787 CAGGGGCTCCTGCGGGGCGCAGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1018652826 6:166005882-166005904 CTAGGGCTCCACAGGGGCAGGGG + Intergenic
1019288438 7:235351-235373 CACGGGCTCCACTGGGCTGCAGG - Intronic
1021759653 7:23891198-23891220 CTCGGGCTCCACAGGGCCAACGG + Intergenic
1022206850 7:28173071-28173093 CTAGGGCTCCTCCAGGGCCCTGG + Intronic
1024944827 7:54798028-54798050 CCCAGGCTGCACCAGGGCGCCGG + Intergenic
1026523058 7:71132741-71132763 CTCGGGCTCCGGCGAGGCGCGGG - Exonic
1032091676 7:128914601-128914623 CTGGGACTCCACTGGGGCCCTGG - Intergenic
1035295376 7:157864364-157864386 CCCGGGCTCCACCTGGGGACGGG + Intronic
1036390331 8:8319027-8319049 CTCGGGCTCCGCCTGGTGGCTGG + Exonic
1039213002 8:35236575-35236597 CGCGGGCCCCACCGAGCCGCAGG + Intronic
1042316788 8:67434636-67434658 CTAGGGCTCCAGCGGGCAGCAGG - Intronic
1042837861 8:73093372-73093394 CCCGGGGACCTCCGGGGCGCGGG + Intronic
1045489259 8:102656349-102656371 CTCGGGGAGCACTGGGGCGCGGG + Intergenic
1049006090 8:139856479-139856501 CTCAGGCTGCAGCGGGGAGCTGG - Intronic
1049812303 8:144580929-144580951 CTCGGGCTCCAGGGAGGAGCTGG + Exonic
1049992126 9:1000218-1000240 CTGCAGCTCCACCGGGGAGCAGG + Intergenic
1050708069 9:8426535-8426557 CTTGGGCTCCACATGGGAGCAGG + Intronic
1051139379 9:13962119-13962141 CACAGACTCCACCGGAGCGCTGG + Intergenic
1051143984 9:14007432-14007454 CTAGGGCTCCAACGGGGGGGGGG + Intergenic
1052915641 9:33922797-33922819 CTTGGGCTCCACTGGGCCCCTGG - Exonic
1057432322 9:95005242-95005264 CGCCGGCGCCACCGGGGCGCAGG - Intronic
1059470951 9:114504747-114504769 CTCGTCCTCCACCGGCTCGCTGG - Exonic
1061138829 9:128752164-128752186 CTCAGGCCACACCGGGGCCCTGG + Intronic
1061671039 9:132188334-132188356 CTCGGGTTCCACGGGGAGGCAGG - Intronic
1061721948 9:132557333-132557355 CTCTGGTTCCACCGGGAGGCCGG - Intronic
1197891860 X:131276946-131276968 CACGAGCTCCACAGGGTCGCTGG + Exonic
1198515857 X:137405970-137405992 CTGGGGCGCCACCGCGGCTCTGG + Intergenic