ID: 925069056

View in Genome Browser
Species Human (GRCh38)
Location 2:951504-951526
Sequence GCACCTGGCTGGGCTCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925069056_925069072 22 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069072 2:951549-951571 TGGGGGCTCTAGGCCATTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 77
925069056_925069069 12 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069069 2:951539-951561 CGGCAGGTGCTGGGGGCTCTAGG 0: 1
1: 0
2: 3
3: 43
4: 404
925069056_925069065 3 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069065 2:951530-951552 GCGCGGCCTCGGCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 302
925069056_925069066 4 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069066 2:951531-951553 CGCGGCCTCGGCAGGTGCTGGGG 0: 1
1: 0
2: 6
3: 22
4: 287
925069056_925069070 20 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069070 2:951547-951569 GCTGGGGGCTCTAGGCCATTCGG 0: 1
1: 0
2: 1
3: 25
4: 188
925069056_925069067 5 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069067 2:951532-951554 GCGGCCTCGGCAGGTGCTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 314
925069056_925069062 -8 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069062 2:951519-951541 CCAGGTGCATGGCGCGGCCTCGG 0: 1
1: 0
2: 3
3: 2
4: 133
925069056_925069064 2 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069064 2:951529-951551 GGCGCGGCCTCGGCAGGTGCTGG 0: 1
1: 0
2: 2
3: 36
4: 584
925069056_925069063 -4 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069063 2:951523-951545 GTGCATGGCGCGGCCTCGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 125
925069056_925069071 21 Left 925069056 2:951504-951526 CCAGTTTGAGCCCAGCCAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 176
Right 925069071 2:951548-951570 CTGGGGGCTCTAGGCCATTCGGG 0: 1
1: 0
2: 2
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925069056 Original CRISPR GCACCTGGCTGGGCTCAAAC TGG (reversed) Intronic
900624738 1:3603034-3603056 GCACATGGCTGGGGTGAACCCGG + Intronic
901520224 1:9778024-9778046 GGACCTGCCTGGGCTCCAAAGGG + Intronic
901623923 1:10612682-10612704 GGACCTGGCTGGGCTGAGAAGGG - Intronic
902279318 1:15362771-15362793 CCACCTGGGTGGGGGCAAACAGG + Intronic
902567013 1:17318249-17318271 GCACCAGGCTGGGCTGCAAGAGG + Intronic
903137720 1:21320253-21320275 ACAGCTGTATGGGCTCAAACAGG + Intronic
905342676 1:37290017-37290039 GCACCTGGCTGGTCACAAGCAGG + Intergenic
905858016 1:41327666-41327688 GCACCTGGCAGCGCTTAACCGGG + Intergenic
905897512 1:41558265-41558287 GGAGGTGGCTGGGCTCCAACAGG - Intronic
911577901 1:99599880-99599902 GCAGCTGCCTGGCCTCCAACCGG - Intergenic
913046865 1:115081206-115081228 GCACCTTCCTGACCTCAAACAGG - Intronic
917578089 1:176345150-176345172 GCTCCTGTCTTGGCTCAAAGGGG - Intergenic
923713250 1:236403792-236403814 GCACCTGGCCTGGCTCACAGAGG - Intronic
1065229553 10:23583333-23583355 GCACCTGGCAGTTTTCAAACAGG - Intergenic
1067053761 10:43039770-43039792 GCGCCTGGCTGCGCTCCAGCTGG - Intergenic
1067090214 10:43262603-43262625 TCTCGTGGCTGGGCTCCAACAGG + Intronic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1067939806 10:50645457-50645479 GCACCTGGGTTGGCTCCCACAGG - Intergenic
1069710235 10:70483329-70483351 GCCCCTGCCTGGGCTGAAGCTGG + Intronic
1070766205 10:79057869-79057891 GGACATGGCTGGGCTCAACTGGG + Intergenic
1072458933 10:95602011-95602033 GCACCTTGCTGGGCTCAGTGGGG + Intergenic
1072810213 10:98455767-98455789 GCTCCTGGCTGGGCACAGAGTGG + Intergenic
1074049852 10:109871660-109871682 GCACCTGGCTGGGCCTGAAGTGG + Intronic
1074310902 10:112322454-112322476 GCTCCTGCCTGGGCTCAGTCTGG + Intergenic
1074856862 10:117480278-117480300 GCAGCTGGCTGGACTGCAACAGG - Intergenic
1075778931 10:125004752-125004774 TCACCAGGCTGGGCTCAGCCTGG - Intronic
1075790954 10:125084240-125084262 GCAGCCGGCTGGGCTCACAGTGG - Intronic
1076372625 10:129964925-129964947 GTACCTGGCGGGGCTCAGACCGG - Intergenic
1076754079 10:132558958-132558980 CCAGCTGGCTGGGCTCGACCAGG - Intronic
1078641267 11:13098941-13098963 GCACAAGGCAGTGCTCAAACAGG - Intergenic
1080848496 11:36047117-36047139 GGACCTGGGAGGGCTCCAACTGG + Intronic
1081568957 11:44277875-44277897 GCATGTGCCTGGGCTCACACAGG - Intronic
1083013126 11:59423087-59423109 GCAGGTGGCTGGGCTTTAACTGG - Intergenic
1083301956 11:61744246-61744268 GCACCAGGTTGGGCTCGAACTGG - Exonic
1083757879 11:64801261-64801283 GCACCTGGCAGGGCTCAGACGGG + Intronic
1083765944 11:64841752-64841774 ACACCGGGCTGGGCTCACCCCGG - Intronic
1083782680 11:64926214-64926236 GCAGCTGGCTGGGCTGATAGTGG - Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085463557 11:76709533-76709555 GGATCTGGCTGGGCTCTAAGAGG + Intergenic
1091228764 11:133974351-133974373 GAACCGGGCGGGGCTCAACCTGG - Intergenic
1091447424 12:551964-551986 GCCCCTGGCTGGGATCACATAGG - Intronic
1091696354 12:2630667-2630689 GTACATGTCTGGGCACAAACAGG - Intronic
1096193222 12:49633298-49633320 CCACCTGGCCTGGTTCAAACTGG - Intronic
1096457439 12:51799256-51799278 GCACCTGATTGGGCTCGAGCAGG - Intronic
1097956740 12:65494674-65494696 GCTGCTGGCTGGACTCAAACAGG - Intergenic
1100677074 12:96879594-96879616 GTCCCTGGCTGGGCACAGACTGG - Intergenic
1101840576 12:108324871-108324893 GGACCTGGCTGTGGTCAGACTGG - Intronic
1103044009 12:117720176-117720198 GCCCCTGGCTGTGCCCAATCAGG - Intronic
1104682597 12:130761824-130761846 GCAACTGGATGGGCTCTAGCGGG - Intergenic
1105211300 13:18258619-18258641 GCACCTGGCTCTGATCAACCAGG - Intergenic
1110535041 13:76641496-76641518 ACACCTAACTGGGCACAAACTGG - Intergenic
1113781241 13:112978886-112978908 GCACCGTGCTGGGCACACACAGG - Intronic
1113944217 13:114034493-114034515 GCACCTGGCTGGTCACCATCAGG + Intronic
1116463969 14:45211362-45211384 GCACCATCCTGGGCTCAACCAGG - Intronic
1121774538 14:96582159-96582181 GCACACAGCTGGGCTCAGACTGG - Intergenic
1128788099 15:70413120-70413142 GCAGTTGGCTGGGCCCAACCAGG - Intergenic
1129221883 15:74135929-74135951 GCACCGGGCTGGACTCCAACTGG - Exonic
1129255753 15:74333116-74333138 TCACCTGGCTGGCCTCCACCTGG + Intronic
1132017007 15:98326883-98326905 GCTCCTGGTTGGGGTCAAAATGG + Intergenic
1133783614 16:8958309-8958331 GCACTTGTGTGGGCACAAACAGG - Intronic
1134901522 16:17942362-17942384 GCTCCTGACAGGGCACAAACTGG + Intergenic
1137592768 16:49703863-49703885 GCACTGGGCTGGGCACAAGCTGG - Intronic
1137774271 16:51042445-51042467 GCACCAGGCTGGGCCCATCCAGG - Intergenic
1141884306 16:86881225-86881247 GCAGCTGGCTGGGCTCGCTCAGG - Intergenic
1142188008 16:88703644-88703666 GCCCCTGGGTGGGCGCAGACAGG - Intronic
1142202180 16:88766531-88766553 GCACCTGGCAGGGCCCAAAGGGG + Intronic
1143273657 17:5694063-5694085 TCACCTGGCTGAGTCCAAACAGG - Intergenic
1144762651 17:17716056-17716078 GCTCCTGCCTGGACTCAAGCTGG - Intronic
1147672594 17:42185191-42185213 GCACCTGCCTTGGCTCACATTGG - Intronic
1147768491 17:42852180-42852202 TCACCAGGCCGGCCTCAAACTGG - Exonic
1147771079 17:42868112-42868134 TCACCAGGCCGGCCTCAAACTGG - Intergenic
1148945625 17:51259960-51259982 GCCCCCGGCTGGGCCCAGACCGG + Exonic
1152236324 17:79140912-79140934 ACACCTGGCTGTGCTCACAGAGG + Intronic
1156341126 18:36211625-36211647 TCACCTGGCTGGGCACAGTCTGG + Intronic
1157782417 18:50451457-50451479 GCACATGACTGTGCTTAAACTGG - Intergenic
1158571911 18:58603482-58603504 GCTCCTGCCTGGGCTAAAGCGGG - Intronic
1160309599 18:77777198-77777220 TCACCTGTCTGGGCTCACGCAGG + Intergenic
1160322963 18:77913887-77913909 GCACCTGGAAGGCTTCAAACAGG - Intergenic
1161273192 19:3401526-3401548 GCACCTGCCTGGGCACATGCAGG + Intronic
1164816632 19:31209172-31209194 GCACCTGGCTGGGCACCCACGGG - Intergenic
1167724226 19:51199875-51199897 GGGCCTGGCTGGGGTCAAAGTGG + Intergenic
1168297471 19:55384371-55384393 GAACCGGGCTGGGCGCGAACCGG + Exonic
925069056 2:951504-951526 GCACCTGGCTGGGCTCAAACTGG - Intronic
926627886 2:15108605-15108627 GCACCTGGCTGGGCTTACCTAGG + Intergenic
927518803 2:23687247-23687269 GCCCCTGGCAGGGCTCACCCAGG - Intronic
928082973 2:28326507-28326529 GCACCTGGCTGGGCTGGGGCTGG - Intronic
931122304 2:59233524-59233546 TCACATGGCTGGGCTCAGAGTGG - Intergenic
932418066 2:71585778-71585800 GCACCTGGCTGGGCTCTCAGTGG + Intronic
933377536 2:81499233-81499255 CCACCTGCCTGGTCTCAATCAGG + Intergenic
933600453 2:84324081-84324103 GCACCTGGCTGGTTTCTCACTGG - Intergenic
936470105 2:112791346-112791368 GCTCCAGCCTTGGCTCAAACGGG + Intergenic
937009786 2:118552196-118552218 GCATCAGGCTGGGCTGAGACAGG + Intergenic
937576486 2:123428827-123428849 GAGGCTGGCTGGGCTCATACTGG - Intergenic
937779772 2:125823608-125823630 GCACCTGGCTCAGCACAAAATGG + Intergenic
939171331 2:138699744-138699766 GAAGCTGGCTGGGATCAAATAGG - Intronic
940717871 2:157248128-157248150 GCATCTGGCTGGGCCCATCCAGG + Intergenic
942450017 2:176103301-176103323 CCACCTGGCTGGGCACATAGAGG + Intergenic
944651398 2:201833940-201833962 TCACCTGGGAGAGCTCAAACTGG + Exonic
944971775 2:205001597-205001619 AAACCTGGGTGGTCTCAAACAGG + Intronic
945834762 2:214826161-214826183 TGACCAGGCTGGCCTCAAACTGG - Intergenic
946340309 2:219062245-219062267 GCACCTGCATGGGCAAAAACTGG - Intergenic
947415882 2:229895479-229895501 GGACCTAACTGAGCTCAAACAGG + Intronic
947415899 2:229895795-229895817 GGACCTAACTGAGCTCAAACAGG + Intronic
947862342 2:233369670-233369692 GGACTTGGCTGGGCACAATCTGG + Intronic
1172531191 20:35632367-35632389 GTACCTGGCTGGACACAATCTGG + Exonic
1173291989 20:41723337-41723359 GTGCCTGGCTGAGCTCAGACAGG + Intergenic
1173291990 20:41723340-41723362 GCACCTGTCTGAGCTCAGCCAGG - Intergenic
1174222981 20:48972172-48972194 CCACCTGGCTGGGCAGCAACGGG - Intronic
1175329601 20:58154278-58154300 TCACTTGGCTGGGCTCATGCTGG - Intronic
1176091544 20:63320607-63320629 GCACCTGGCTGGGCCCACAGAGG - Intronic
1176293976 21:5060808-5060830 GCACTTCTCTGGGCTCCAACAGG + Intergenic
1178673771 21:34614492-34614514 GCACCAGCCTGGGCGCACACGGG + Intronic
1179863283 21:44202840-44202862 GCACTTCTCTGGGCTCCAACAGG - Intergenic
1180203871 21:46244855-46244877 GCACCTGGCCTGGCTGAAGCAGG - Exonic
1180764935 22:18340818-18340840 GCACCTGGCTCTGATCAACCAGG + Intergenic
1180814096 22:18778866-18778888 GCACCTGGCTCTGATCAACCAGG - Intergenic
1181082258 22:20423490-20423512 GCAGCTGGCAGGACACAAACAGG - Intergenic
1181109283 22:20591837-20591859 GCACCTGCCTGGGCTCAGGGAGG - Intergenic
1181200279 22:21213201-21213223 GCACCTGGCTCTGATCAACCAGG - Exonic
1181440184 22:22931699-22931721 GCACCTGGCTGGGGTCTCACGGG + Intergenic
1181539961 22:23567732-23567754 GCTGCTGGCTGGGCTCCAGCTGG + Intergenic
1181677538 22:24466058-24466080 GCACCTGGCTGAGCTACACCTGG + Intergenic
1181701459 22:24623758-24623780 GCACCTGGCTCTGATCAACCAGG + Exonic
1183096573 22:35555571-35555593 GCAGCAGGCTGGGCTCCAGCGGG - Intergenic
1183377966 22:37476017-37476039 GAACCTGGCTGACCTCAGACTGG + Intronic
1183505771 22:38208082-38208104 CCAGCTGGCTGGGGTCACACAGG - Intronic
1184201537 22:42972626-42972648 GCACCAGGATGGGCCCAAAGTGG + Intronic
1184253915 22:43276418-43276440 CCACCTGGCTGGCCTCAGGCGGG + Intronic
1203226557 22_KI270731v1_random:81723-81745 GCACCTGGCTCTGATCAACCAGG + Intergenic
1203264193 22_KI270734v1_random:4553-4575 GCACCTGGCTCTGATCAACCAGG - Intergenic
954130512 3:48558399-48558421 GCTCCTGGCTGGGTACACACTGG - Intronic
954441796 3:50526170-50526192 ACACGTGGCTGGGCTCAGGCTGG + Intergenic
954603243 3:51888724-51888746 GAGCCAGGCTGGGCTCAAATGGG + Intergenic
954862222 3:53700666-53700688 GCACGTGTCTGGGCTCAGATCGG + Intronic
959595234 3:108122304-108122326 CCACCTGCCTGAGCTCAAGCCGG - Intergenic
961663950 3:128485054-128485076 GCAGCTGGCTGGGGCCAAACTGG - Intronic
967108960 3:186276104-186276126 GCATCTGGCAGGGCACAAAAAGG - Intronic
968453227 4:684718-684740 GTTCCTGGATGGGCTCAAGCTGG - Exonic
968594309 4:1474387-1474409 TCACCTGGCTGGGCACCAGCAGG + Intergenic
968960020 4:3738791-3738813 GCGCCTGGCTAGGTTTAAACTGG + Intergenic
969167650 4:5330682-5330704 GCATCTGGCTGGGTTCCAAGAGG + Intronic
978611008 4:110539597-110539619 TGACCAGGCTGGTCTCAAACTGG + Intronic
984427696 4:179608863-179608885 TCACCAGGCTGGTCTCGAACTGG - Intergenic
985995120 5:3593466-3593488 GGACCTGGCTGGGCCCCACCTGG - Intergenic
992609269 5:78493253-78493275 GGGCCAGGCTGGGCTCAGACAGG - Intronic
997301404 5:132808576-132808598 ACAATTGGCTGAGCTCAAACTGG - Intergenic
1002384353 5:178855188-178855210 GAACCTGGCTGAGCTCCAGCAGG + Intergenic
1002554740 5:180027579-180027601 GCAGCTCGCTGGACTGAAACAGG + Intronic
1002569830 5:180134042-180134064 GGATCTGGGTGGGCTCAAGCTGG + Intronic
1002644574 5:180646846-180646868 CCACATGGCTGGGCCCAGACAGG - Intronic
1004692353 6:18003486-18003508 TAGCCAGGCTGGGCTCAAACTGG - Intergenic
1007168832 6:39847971-39847993 GCACCTCTCAGGGCTCAAAAAGG - Intronic
1008904408 6:56660240-56660262 GCACATGGCTGGGTTCATACAGG + Intronic
1013308768 6:108873844-108873866 TTACCTGGCTGGGGTCACACTGG + Intronic
1016453346 6:144206499-144206521 ACACCTCTCTGGACTCAAACTGG - Intergenic
1018632550 6:165833659-165833681 GCCCCTGGCTGTGCTCAGCCTGG - Intronic
1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG + Intronic
1023939194 7:44759334-44759356 GCCCAGGGCTGGGCGCAAACTGG - Exonic
1026205072 7:68250198-68250220 ACACATGGCTGGGCTGGAACCGG + Intergenic
1026459142 7:70598122-70598144 GCACCTGGAAGGGCTGAGACTGG - Intronic
1026913995 7:74108886-74108908 TCACCTGGCGGGGCACAAACAGG - Exonic
1028946662 7:96587556-96587578 TCACCTGGCTGTGCACCAACCGG - Intronic
1029606544 7:101602638-101602660 GCACCAGGCTGTGCACAGACTGG + Intergenic
1033599492 7:142878394-142878416 GCACCTGGTGAGGGTCAAACAGG - Intronic
1035555675 8:565566-565588 GCGGCGGGCTGGGCTCAGACTGG - Intergenic
1036615447 8:10384088-10384110 GCACATAGCTGGCCTGAAACTGG - Intronic
1036721894 8:11183516-11183538 CCACCATGCTGGGCTCAAGCTGG + Intronic
1038778191 8:30549602-30549624 GCACCTGGCTTAGCTCTCACAGG + Intronic
1039480689 8:37871302-37871324 GCGCCTGGCTGAGCTGAGACTGG + Exonic
1041740747 8:61153843-61153865 CCACCTGGCAGGCCTGAAACTGG + Intronic
1044787193 8:95807195-95807217 GCAGCTGTCTGTGTTCAAACTGG + Intergenic
1046160270 8:110353927-110353949 GTACCTGACTGGGCTAAAAATGG - Intergenic
1046631388 8:116626052-116626074 GCACCTCCCTTGGGTCAAACCGG - Intergenic
1047657032 8:126989157-126989179 GCCCCTGGCAGGGCTCCTACTGG - Intergenic
1049206242 8:141364984-141365006 GCACCTGCCTGGCCTCAGCCTGG + Intronic
1049241818 8:141541662-141541684 GCACCTGGCTGGCCCCACCCAGG - Intergenic
1049672905 8:143877667-143877689 GCAGCTGCCTGGGCCCACACAGG + Intronic
1050710636 9:8458641-8458663 GCTCCTGCTTGGACTCAAACAGG + Intronic
1056268779 9:84925787-84925809 TCATCTGGCTGGACTAAAACTGG - Intronic
1057044967 9:91878583-91878605 GTGCCTGGCTGGGCTCAAATTGG + Intronic
1057209181 9:93190406-93190428 GCGCCTGGCTGAGCTGAATCAGG + Intronic
1057279572 9:93700055-93700077 GCACTTGGCTTGGCCCAAAGAGG + Intergenic
1057551908 9:96057291-96057313 GGACCTGGCTGGGCCCTGACTGG + Intergenic
1058861768 9:109123426-109123448 GCACAAGGCTGGGTTCACACAGG + Intergenic
1061006224 9:127929768-127929790 GCCCCGGGCTGATCTCAAACAGG + Exonic
1062042078 9:134408792-134408814 ACCCCTGCCTGGGCTCAGACTGG - Intronic
1062161364 9:135082040-135082062 GCCCCTGCCTGGGCTCCAGCTGG + Intronic
1186195709 X:7108759-7108781 GGCCCAGGCTGGTCTCAAACTGG + Intronic
1186470962 X:9822043-9822065 GCCCCAGGATGGGCTCTAACAGG - Intronic
1187918347 X:24176808-24176830 GCACCTGGTTGGACTCAGCCTGG + Intronic
1188871467 X:35378580-35378602 TCTCCAGGCTGGTCTCAAACTGG + Intergenic
1190711213 X:53071968-53071990 GCACGTGTCTGGGCTCGAGCAGG + Intronic