ID: 925069382

View in Genome Browser
Species Human (GRCh38)
Location 2:954632-954654
Sequence CATTTAATACAGAAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 348}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925069382_925069384 -5 Left 925069382 2:954632-954654 CCTTCCTATTTCTGTATTAAATG 0: 1
1: 0
2: 2
3: 21
4: 348
Right 925069384 2:954650-954672 AAATGCTAAGCTCCCCTATGTGG 0: 1
1: 0
2: 0
3: 4
4: 95
925069382_925069389 15 Left 925069382 2:954632-954654 CCTTCCTATTTCTGTATTAAATG 0: 1
1: 0
2: 2
3: 21
4: 348
Right 925069389 2:954670-954692 TGGGTGTAATCCCTCACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 127
925069382_925069385 -4 Left 925069382 2:954632-954654 CCTTCCTATTTCTGTATTAAATG 0: 1
1: 0
2: 2
3: 21
4: 348
Right 925069385 2:954651-954673 AATGCTAAGCTCCCCTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925069382 Original CRISPR CATTTAATACAGAAATAGGA AGG (reversed) Intronic
902747157 1:18481798-18481820 CATTTCATACAGAAGGCGGAGGG + Exonic
903098131 1:21000391-21000413 CTATTAATGCAGAAATAGAATGG + Intronic
903108497 1:21107028-21107050 CATTTAAAACAAAAAAAGTATGG + Intronic
904444958 1:30563377-30563399 CATTTGAAACAGAAAAGGGAGGG + Intergenic
905590776 1:39161401-39161423 CTTTTAAAACAGAAATATAATGG + Intronic
907963694 1:59308382-59308404 CAGCTATTACAGTAATAGGAAGG - Intronic
908097322 1:60752577-60752599 CATTTTATAAATAAATAGGCTGG - Intergenic
908850071 1:68366970-68366992 CATTTTAAAAAGAAATAGAACGG - Intergenic
909116944 1:71549311-71549333 CAGATAATACAGTAATAAGACGG - Intronic
910040302 1:82843512-82843534 GGTGTAATACAGAAATAAGATGG - Intergenic
910962342 1:92776235-92776257 ATTTTAACACAGAAAAAGGATGG + Intronic
911852868 1:102840763-102840785 CAATTAATACATAAACAGAAAGG + Intergenic
912000237 1:104823959-104823981 AATTTAATACAGAAAAACAAAGG + Intergenic
912149153 1:106835491-106835513 CATTTAATCTAGAAATAAGCTGG - Intergenic
916078591 1:161218025-161218047 AATTCCATACAGAAACAGGATGG - Exonic
917890925 1:179437577-179437599 CAATTAATACATAAACAGAAAGG - Intronic
918883147 1:190153453-190153475 CATTTAATACATAAATGTAAGGG + Intronic
919203839 1:194394554-194394576 AATTTAATACAGAAAGAGGTGGG + Intergenic
920026335 1:203000410-203000432 CAGATAATACATAAATAGGTAGG + Intergenic
921474396 1:215589067-215589089 CATTTAATCCAGAAATTGTTTGG - Intronic
922350335 1:224729978-224730000 CATTTATCACAAATATAGGAGGG - Intronic
922522948 1:226273130-226273152 CATTTAATACAACAATAGGATGG + Intronic
922633868 1:227144038-227144060 CCTTGAATACAGTACTAGGATGG + Intronic
924523631 1:244827492-244827514 CATTTTATTTAGAAATAAGAAGG + Intergenic
924661162 1:246018533-246018555 CAATTTTTACAGAAATATGATGG - Intronic
924910399 1:248505865-248505887 ATTTTAAAACAGAAATATGACGG - Intergenic
924913701 1:248542174-248542196 ATTTTAAAACAGAAATATGACGG + Intergenic
1063131644 10:3183155-3183177 CTTTTAAATCAGAATTAGGAGGG + Intergenic
1063286221 10:4691934-4691956 CCTTTAACACAGACATAGGCTGG - Intergenic
1064640696 10:17412441-17412463 CACTTAATGCAGGAATAGTATGG - Intronic
1065039508 10:21677345-21677367 CATATAATAAATAAGTAGGAAGG + Intronic
1065064789 10:21950226-21950248 AATGTGATACAGAAACAGGAAGG - Intronic
1065163164 10:22944688-22944710 CCTTTAATACCTAAAGAGGATGG + Intronic
1065630572 10:27676686-27676708 CATTTATTTCAGACAAAGGATGG + Intronic
1067916818 10:50408677-50408699 CATTTAAAAAAAAAATAGCAGGG + Intronic
1068341586 10:55711307-55711329 CAAATTATTCAGAAATAGGAGGG - Intergenic
1069438775 10:68408858-68408880 CAATAAATACAGCAATATGAAGG + Intergenic
1069460427 10:68589970-68589992 CATTTAATATAAAAATTGGAAGG - Intronic
1069758988 10:70794899-70794921 CATCTAATAATGAAACAGGATGG + Intergenic
1070479265 10:76865966-76865988 CGTCTAAGACAGAAATGGGAGGG + Intergenic
1071901187 10:90121641-90121663 AATTTAATACAGAAAATGAAAGG + Intergenic
1072058329 10:91783108-91783130 GAGTTAAAACAGAAATAAGAAGG - Intergenic
1072342395 10:94466229-94466251 CATTTAATACAGAAATATACTGG - Intronic
1072342530 10:94468189-94468211 CATTTAATACAGAAATATACTGG - Intronic
1073220749 10:101871332-101871354 AATTTTATACAGAAATGGAAAGG + Intronic
1073858670 10:107709653-107709675 CATTTAATTCAAATATAGAAGGG + Intergenic
1076017158 10:127037086-127037108 CATTTTATATAGAAAAAGCAAGG - Intronic
1076040802 10:127246866-127246888 CATTTAATAGAGAAAAAATAGGG + Intronic
1077057808 11:604001-604023 CATTTAAAACTAAAATAAGAGGG - Intronic
1079208248 11:18436848-18436870 CATGTATGACAGAAAGAGGATGG - Intronic
1080202788 11:29692673-29692695 CATTTCAGACAGTAAGAGGAAGG + Intergenic
1081495422 11:43605202-43605224 CACCTAAGACAGAAATGGGAAGG - Intronic
1085749163 11:79145330-79145352 CTTTTAATTCAGAGGTAGGAGGG - Intronic
1086328470 11:85728851-85728873 CATTCAATACATCAATAGTAAGG - Intronic
1086392704 11:86381797-86381819 CATTTAATAGAGAGTAAGGATGG + Intronic
1087552549 11:99670151-99670173 AATTTAATACATAAATAGTGGGG - Intronic
1087775450 11:102252650-102252672 CATTTAGTAGAGAAGTAAGAAGG - Intergenic
1088838909 11:113605800-113605822 CATTAAAGACAGGAATAAGAAGG - Intergenic
1090046246 11:123336828-123336850 CATTTAAAAATGAAATAGAAAGG + Intergenic
1090155749 11:124436899-124436921 CGTTTAATACATCCATAGGATGG + Intergenic
1091012927 11:132022926-132022948 CATTTATCACATTAATAGGAAGG - Intronic
1092608188 12:10143346-10143368 GATTGAAGACAGAAATAGTAAGG + Intergenic
1093615789 12:21222529-21222551 TATTTATCACAGAAATAGAAAGG - Intronic
1093773574 12:23046425-23046447 CATTTGATATGGGAATAGGATGG - Intergenic
1095247277 12:39937572-39937594 TATATAATTCAGAAAAAGGAAGG + Intronic
1095334660 12:41010790-41010812 CATTTAATGCACATATTGGAGGG - Intronic
1095487167 12:42697239-42697261 CATATATTACTGAAATGGGAAGG - Intergenic
1095524853 12:43113194-43113216 TATTTAATGCAGAAATATGAAGG - Intergenic
1098101703 12:67024598-67024620 CATTTAGAACACAAATAAGATGG - Intergenic
1098514828 12:71362436-71362458 CATGTACCACAGAAATAGGAGGG + Intronic
1100003400 12:89864763-89864785 CTTTTAATACACAGATATGAGGG + Intergenic
1101148197 12:101861549-101861571 TGTTCAATAAAGAAATAGGAAGG - Intergenic
1101618445 12:106360422-106360444 GATTTAATCTACAAATAGGAAGG - Intronic
1102088134 12:110160997-110161019 TACTTAATAGAGAAATATGAGGG - Intronic
1102553493 12:113710348-113710370 CATGTAATTGAGAAAGAGGAAGG + Intergenic
1103563165 12:121803249-121803271 CCTTTAATAAAGAAAGGGGAAGG + Intronic
1106134688 13:26965304-26965326 CATTTAACACAGAATGAGGAGGG - Intergenic
1106507635 13:30385217-30385239 CATATCCTACAAAAATAGGAGGG + Intergenic
1108013244 13:46044671-46044693 AATTTAATACATAATTAGGGGGG + Intronic
1108566060 13:51699104-51699126 CATGTAATTCAGAAGTAGCAGGG - Intronic
1108627391 13:52244372-52244394 CATTTATTCCAGAAATATGTTGG + Intergenic
1108658676 13:52562095-52562117 CATTTATTCCAGAAATATGTTGG - Intergenic
1110583896 13:77164944-77164966 CTTTTAATACATGAAGAGGATGG - Intronic
1111450983 13:88415426-88415448 CAGTTAATACAAAAACAGAAGGG - Intergenic
1111499981 13:89105837-89105859 CATTTAAGAATGAAAAAGGAAGG + Intergenic
1112026763 13:95418679-95418701 CATTTACTACAGAAATACATAGG - Intergenic
1112930825 13:104734872-104734894 CATTTAACATAGAAAAATGATGG - Intergenic
1113152971 13:107284900-107284922 CATTTAAAAAAAAAATAGGATGG - Intronic
1113726084 13:112603275-112603297 CTTTTAATACAAAGATAGGCTGG - Intergenic
1115001070 14:28420441-28420463 CAATTAATACATAAACAAGAAGG + Intergenic
1115230480 14:31154962-31154984 CAATGAATACAGAAATTGGTGGG + Intronic
1115427410 14:33276284-33276306 CAGTTAACACAGTAATAAGAAGG + Intronic
1115932795 14:38516368-38516390 CAAATATTACAGAAATAAGAGGG + Intergenic
1116228767 14:42188296-42188318 AATTTAATATAGAAATGGGTTGG + Intergenic
1118143542 14:63111484-63111506 CATTTAATAGAGAGATTTGAAGG + Intergenic
1118879671 14:69815570-69815592 CAATTAATACATAAACAGAAAGG + Intergenic
1119071314 14:71587811-71587833 CATTTAAAACACAGATATGATGG + Exonic
1119457862 14:74771851-74771873 CATTTAAAATAAAAATAGGTGGG + Intronic
1119542175 14:75447044-75447066 GATTTAATATAGAACTAGGGAGG + Intronic
1119874339 14:78044708-78044730 CAACCAATACAGAAATAGTATGG + Intergenic
1120404899 14:84082955-84082977 AATTTAATACAGAGGTAGGCTGG + Intergenic
1120703384 14:87723253-87723275 CATTTAACTCTGAAATGGGATGG + Intergenic
1121971649 14:98362962-98362984 CATTTATTACAGATCAAGGAAGG + Intergenic
1125029151 15:35059175-35059197 TCTTTAGTACAGAAATAAGAAGG - Intergenic
1125502593 15:40248694-40248716 CGTGTTACACAGAAATAGGAAGG + Intronic
1126172118 15:45703936-45703958 CATTTACTACAAGGATAGGAAGG + Intergenic
1126506773 15:49413959-49413981 CATTTAACACAGAAAGGAGAAGG - Intronic
1126812367 15:52420433-52420455 CATGTAAGACAGAGACAGGAAGG - Intronic
1126936487 15:53714767-53714789 CACTTACTTCCGAAATAGGAAGG - Intronic
1128718779 15:69930152-69930174 CATTGAATACAGAGTTGGGAGGG + Intergenic
1131954915 15:97724575-97724597 GATCTAATACAGAAATATTAAGG + Intergenic
1132173015 15:99683006-99683028 AATTTTATTCAAAAATAGGAAGG - Intronic
1134971421 16:18534275-18534297 CAGTTCATACACAAATGGGAGGG - Intronic
1138772681 16:59684602-59684624 CATTTAATACAGAAAATAGGTGG + Intergenic
1138836316 16:60440127-60440149 CATTTAATATAATAATAAGAAGG + Intergenic
1138960211 16:62020192-62020214 GATTTAAAAGAAAAATAGGAGGG - Intronic
1139128441 16:64110560-64110582 CACTTCATACAGTAACAGGATGG - Intergenic
1139202164 16:64988944-64988966 CATTAAATAAATATATAGGAGGG - Intronic
1142437384 16:90070204-90070226 CATTTAATACCTCAATATGATGG + Intronic
1143259856 17:5590299-5590321 AATATAATACAGAAATATGTAGG + Intronic
1143807811 17:9443790-9443812 CATTTAGTAGAGAAATACAAAGG - Intronic
1146362746 17:32191198-32191220 CATTTAAAACAAGAATAGAAGGG + Intronic
1146981339 17:37164549-37164571 CATTAAAGACAGAGAAAGGAAGG + Intronic
1147182058 17:38692721-38692743 AAATTAATAAATAAATAGGATGG + Intergenic
1148327487 17:46791686-46791708 CATTCATCACAGAAGTAGGAAGG + Intronic
1148473781 17:47913406-47913428 CAGTAAGTACAGAAATAAGAGGG - Intronic
1148657880 17:49301883-49301905 CATTTAACACAGAAGTTGAAGGG - Intronic
1148997905 17:51727733-51727755 TATTTGATAAATAAATAGGATGG - Intronic
1149088460 17:52749810-52749832 CATGTAATAAAGAAAGAGGCAGG - Intergenic
1150156086 17:62854492-62854514 CATTTAATATAAAAAAAAGAAGG + Intergenic
1153073821 18:1138839-1138861 CAGACATTACAGAAATAGGAAGG - Intergenic
1153581693 18:6580530-6580552 CATTTAACACATGAATAAGAAGG + Intronic
1155336535 18:24770739-24770761 CATTTAATGTAGTAACAGGAAGG + Intergenic
1155567909 18:27157503-27157525 CATTTAATAGAGAAATAGCATGG + Intronic
1155647187 18:28093383-28093405 CATGTAATAAAGGAATAAGATGG + Intronic
1158179221 18:54694744-54694766 TATTTAATAGAGAATTAGCAAGG + Intergenic
1159396563 18:67865501-67865523 GTTTTAATACAGAGATAGCAGGG - Intergenic
1159403990 18:67976581-67976603 CATTGAATTCAGAATCAGGATGG - Intergenic
1161349304 19:3783506-3783528 CCCTTAATGCAGAAATAGGGGGG - Intronic
1161653649 19:5499741-5499763 CATTTAATTCAGAAATGAGGTGG + Intergenic
1162580984 19:11530154-11530176 CAGTAAATAAATAAATAGGAAGG + Intergenic
1167826805 19:51980992-51981014 CAATTAATACATAAACAGAAAGG + Intronic
1168363091 19:55759573-55759595 CTTTTAATTCAGAAAGAGAAAGG + Intronic
925069382 2:954632-954654 CATTTAATACAGAAATAGGAAGG - Intronic
925476542 2:4222976-4222998 TATTAAATACAACAATAGGAAGG - Intergenic
926763138 2:16297192-16297214 CCTTTAATACTGAGACAGGAAGG + Intergenic
926978323 2:18537126-18537148 GTTTTTATACAGAAATAGTAAGG - Intergenic
927007118 2:18862185-18862207 CATGTAGAACAGAAACAGGAAGG + Intergenic
928203082 2:29263677-29263699 CATTGCAGACAAAAATAGGAGGG - Intronic
928752728 2:34489293-34489315 AATTAAAGAAAGAAATAGGATGG - Intergenic
929046182 2:37792832-37792854 AAGTTAATACAACAATAGGATGG - Intergenic
929258011 2:39834199-39834221 ACTGTGATACAGAAATAGGAAGG - Intergenic
929422899 2:41812693-41812715 AAACTAATACAGAAATAGGATGG + Intergenic
929894105 2:45943600-45943622 CATTTAAGACAGAAAAAAAAAGG - Intronic
930123514 2:47779102-47779124 CATTTAATAGGGGAAGAGGAGGG + Intronic
930403823 2:50928543-50928565 TATTTAGTACAGAAATAAAATGG - Intronic
930926794 2:56827996-56828018 CATTTTATAAAGAAATGGCATGG + Intergenic
931375732 2:61706230-61706252 CATTTAAGTCAAAAAAAGGAAGG + Intergenic
932830978 2:74989652-74989674 GATTTAATACAGTAAAAGGGTGG - Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
933183456 2:79252944-79252966 CATTTAATAAAGAGAAAGTAAGG + Intronic
933260176 2:80123660-80123682 CATTTGTCACAAAAATAGGAAGG - Intronic
933485077 2:82910961-82910983 CATTTAATATAGGAATAATAAGG - Intergenic
935068255 2:99670818-99670840 CTTTTATTGCAAAAATAGGAAGG + Intronic
938508690 2:131915947-131915969 CAATTAATACAAAGATTGGAAGG + Intergenic
939972227 2:148675536-148675558 CATTTTATACAGATAGAAGAGGG - Intronic
941642634 2:168005553-168005575 CATTTAATAAATAAATATGTTGG - Intronic
942143412 2:173001258-173001280 CATTTAAAACAGAATCTGGAAGG - Exonic
943007234 2:182400696-182400718 AGTTTAATACAGTAAGAGGAAGG + Intronic
943416093 2:187606437-187606459 GATTTAATACAGAAAGTGGGTGG + Intergenic
945937528 2:215918106-215918128 CATGAAATACAGAGTTAGGAAGG + Intergenic
946743116 2:222819199-222819221 CATTTCCTACAGGAATAGCAGGG + Intergenic
946995576 2:225387511-225387533 CATTTATTTCAGACATAGAATGG + Intergenic
947021529 2:225682769-225682791 AATTTGAATCAGAAATAGGATGG + Intergenic
947296060 2:228631839-228631861 CAGATAATACAGAGTTAGGAAGG + Intergenic
947454105 2:230237416-230237438 CATTTACTACAGAAGAAGGGAGG - Intronic
948163937 2:235846625-235846647 TATTTAATAAATAAATAGGTTGG - Intronic
1171048468 20:21833388-21833410 CAGTTAATGCAGCAGTAGGAAGG - Intergenic
1172611189 20:36253652-36253674 CATTTAATACAAACATGGGCAGG - Intronic
1174370854 20:50086318-50086340 CACTAAACACAGAAAAAGGAGGG + Intronic
1175262993 20:57686422-57686444 CATTTGAGAGAGAAAAAGGAAGG - Intronic
1176784801 21:13242592-13242614 CAATTAATACAAAGATTGGAAGG - Intergenic
1177054644 21:16286057-16286079 CAATTAAGACAGAAATGTGATGG + Intergenic
1177104275 21:16935131-16935153 CATTATCTACAGAAATAGTAGGG + Intergenic
1177236464 21:18396170-18396192 CTTTTTCTACAGAAATAAGAAGG - Intronic
1177286189 21:19053937-19053959 CATTTAATAGAGAAACTAGAAGG - Intergenic
1177982840 21:27936428-27936450 CAATTAATACAAAGATTGGAAGG - Intergenic
1178390456 21:32193646-32193668 CATTTCTTAGAGAAATAGAATGG - Intergenic
1179062328 21:37990416-37990438 AATTTAAAAGAGAAAGAGGAAGG + Intronic
1180550602 22:16533642-16533664 TATTAAATAAATAAATAGGATGG + Intergenic
1181129676 22:20723532-20723554 TATTAAATACAAAAATAGGCTGG + Intronic
1182538382 22:31023372-31023394 CATATAATCAAGAAATAGGCTGG - Intergenic
1182570276 22:31232126-31232148 CATTTTATACTAAAACAGGAAGG + Intronic
949297537 3:2543347-2543369 CATTTAATAAACAAATAATAAGG + Intronic
950859284 3:16133267-16133289 CAGTTAATTCAGAAATATGGGGG + Intergenic
951154298 3:19330712-19330734 CATATAGTACAAACATAGGAGGG + Intronic
951551984 3:23883320-23883342 CATTTTATCGAGAAATAGGTGGG + Intronic
952026778 3:29092424-29092446 CATTTAATATAGAATGAGAAAGG + Intergenic
952204962 3:31172088-31172110 CATATAACACAGGCATAGGACGG + Intergenic
952683842 3:36127114-36127136 CAGATACTACAGAAATACGAAGG + Intergenic
952801388 3:37295670-37295692 TATTTAAAACAGAGAGAGGACGG - Intronic
953803375 3:46046588-46046610 CAATTAATACATAAACAGAAAGG - Intergenic
954120232 3:48493827-48493849 CAGTTAAAAAAGAAATCGGATGG - Intronic
954417739 3:50402153-50402175 CAATCAATACAGAAAGAGGTCGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956557682 3:70540690-70540712 CTTTTAAAACAGAGATAGGGAGG - Intergenic
957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG + Intergenic
957958679 3:87222627-87222649 CAATCAATACAGAAATAAAATGG - Intergenic
958130527 3:89414898-89414920 ACTTGAAGACAGAAATAGGAAGG - Intronic
958671180 3:97206758-97206780 GATTTAATAGAGAAGTAGGGGGG - Intronic
959576226 3:107937293-107937315 CATTAAAGATAGAATTAGGAAGG - Intergenic
959605683 3:108239093-108239115 GATTTAATAAAGCAATAGGTTGG + Intergenic
959628888 3:108485405-108485427 CCTTTAAAAGAGAATTAGGAAGG + Intronic
959684947 3:109134834-109134856 CATTTAATACAGCAATTCTATGG - Intergenic
961577873 3:127853235-127853257 CATTTTAAACAGAAATAGCTGGG - Intergenic
961927191 3:130493498-130493520 CATGTTATTTAGAAATAGGAAGG - Intergenic
963665254 3:148176693-148176715 CATTTATCACAGAAATAACAAGG + Intergenic
963956593 3:151261113-151261135 CATTTAATTCTGAAATAAGAGGG + Intronic
964928061 3:161981350-161981372 CAACTGATACAGAAATAGAAAGG - Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
968253503 3:197245034-197245056 CCTTTAATAAGGCAATAGGAAGG + Intronic
969158533 4:5234582-5234604 CTTATAATACAGAAATAAAAAGG - Intronic
970113257 4:12662771-12662793 CATCAAATAGAGAAAGAGGAAGG + Intergenic
970262847 4:14247217-14247239 CATTTCATACATAAAAAGTAGGG + Intergenic
970937514 4:21591084-21591106 TATTTAACAAAGAAAAAGGAAGG + Intronic
971052742 4:22879489-22879511 CATTTGATACTGAATTAGGTAGG + Intergenic
971630842 4:28991699-28991721 AATTTAATAAAGAAATTGTATGG + Intergenic
972058532 4:34835860-34835882 CATTTTATACAGAAATACTCAGG - Intergenic
975167883 4:71198667-71198689 CATATAAGAGAGAAATAGGCTGG + Intronic
975737192 4:77392704-77392726 CAATTAATACATAAACAGAAAGG - Intronic
976819115 4:89184986-89185008 CATTTAAAACAGAAAAAGTAAGG + Intergenic
976968180 4:91070875-91070897 CATTTAATAGAAAAACATGATGG + Intronic
977779451 4:100963401-100963423 CATTTTGTACAAAAATATGAAGG + Intergenic
978040149 4:104050625-104050647 CATTTAATAAAGGAATTGGGGGG - Intergenic
978542922 4:109838085-109838107 CATATCATTCAGAAATAAGAAGG - Intronic
979889440 4:126072495-126072517 AATTTAAAACTAAAATAGGATGG - Intergenic
980348452 4:131656135-131656157 CATTTAATAGAGAAATAAACAGG - Intergenic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981425387 4:144596890-144596912 CAGTTAGTAGAGAAATAGAAGGG + Intergenic
981727533 4:147862823-147862845 TATTTAATAAAGACATAAGAAGG - Intronic
981841202 4:149114601-149114623 CATGTTATTCAGAAATATGAAGG + Intergenic
982295489 4:153823850-153823872 CATGTATTACATAAAAAGGATGG + Intergenic
982404099 4:155001513-155001535 CATTTAATCCAAACATTGGAGGG - Intergenic
983628972 4:169829928-169829950 CAATTAAAAAAGAAAAAGGAGGG + Intergenic
983726472 4:170934662-170934684 CCTTTGATAGAGAAATAGCAAGG + Intergenic
984380062 4:178981698-178981720 GATATAATACAGAAATAAGATGG - Intergenic
987399958 5:17464450-17464472 CTAAAAATACAGAAATAGGAGGG - Intergenic
988162584 5:27540164-27540186 CATTTAAAAAAGAAACATGAAGG - Intergenic
988637505 5:33001507-33001529 AAATTAATACAGAAATGCGAAGG - Intergenic
989301496 5:39899553-39899575 CATGTAGTACAGAAACAAGAGGG - Intergenic
989726483 5:44593162-44593184 CATTAAATACATAAATTTGAAGG - Intergenic
990064029 5:51689932-51689954 CATTCATTACAGAAAGATGATGG - Intergenic
990882245 5:60552347-60552369 CATTGAATACTGAAGTATGATGG + Intergenic
991557788 5:67914894-67914916 CATTTAACACAAAAATTGAAAGG + Intergenic
991912734 5:71577892-71577914 CACTTAATACATAAACAAGAAGG + Intergenic
992611586 5:78512731-78512753 CATTTAACAGAGAAAAGGGATGG - Intronic
995292399 5:110471913-110471935 CATATAACACAGAAATGGAAAGG + Intronic
995848267 5:116517834-116517856 CATTTTCTACAGAGAGAGGAAGG - Intronic
996229603 5:121045465-121045487 CATTCAATACAGAATTATGATGG + Intergenic
998314068 5:141164116-141164138 CATTTAATACCAAAACAGAATGG - Intergenic
998958314 5:147459547-147459569 CATTGAATACAGAAATAAACTGG + Intronic
1000425483 5:161085693-161085715 CATTTAATACAGAATTATTTGGG + Intergenic
1000971219 5:167716766-167716788 CCTATAATACAGAAATCCGAAGG + Intronic
1003379631 6:5611560-5611582 CATTTAATCCACTAATAGGTAGG - Intronic
1003800110 6:9654569-9654591 CATTTTGTACATACATAGGAGGG + Intronic
1003815052 6:9830336-9830358 CCTTTCATACAAATATAGGAGGG - Intronic
1004197632 6:13519300-13519322 CAGTTTATACAGAAAAAGGCAGG - Intergenic
1005413300 6:25573726-25573748 CTTTTAATACAGAACTGAGATGG - Intronic
1007021705 6:38527835-38527857 CATGAAAATCAGAAATAGGAAGG + Intronic
1007438845 6:41840076-41840098 CATTTAAAAAAAAAATAGGCCGG + Intronic
1008473752 6:51913548-51913570 AATGTACTACAGAAAGAGGAAGG - Intronic
1008737155 6:54558970-54558992 CAGTTAAGACAGAAATTGTAGGG - Intergenic
1008741969 6:54619938-54619960 TATGTAATAAAGAAATAAGAAGG - Intergenic
1009335565 6:62486257-62486279 CATTAAATACATAAATAGAAGGG - Intergenic
1009666434 6:66687103-66687125 TAATGAATACAGACATAGGAAGG - Intergenic
1010451795 6:76012384-76012406 AAGTAAATACAGAAATAGGGTGG - Intronic
1010657869 6:78533376-78533398 TATTTAATCCAGAAAAAGGTAGG - Intergenic
1010705724 6:79107266-79107288 CATATAACACAGACATAAGAAGG + Intergenic
1011351032 6:86424001-86424023 TATTTAATCCAGAAATATCAAGG + Intergenic
1011585593 6:88921750-88921772 TTTTTAATACAGATATAGGAAGG - Intronic
1012313572 6:97757607-97757629 CATTTCAAAAAGAAATAGGCAGG + Intergenic
1012562451 6:100599915-100599937 TAATTAATACAGAATTAGAATGG + Intronic
1012836442 6:104275251-104275273 AATTTAAAAAAGAAATAGGCCGG - Intergenic
1012836480 6:104275757-104275779 CATTTTATACAAAATTAGCAAGG - Intergenic
1013150890 6:107445496-107445518 CATTTGATGCAGAAATATTAAGG - Intronic
1013564917 6:111348513-111348535 AATTTAGTCTAGAAATAGGAAGG - Intronic
1013713690 6:112932218-112932240 CATTTATTTTAGAAGTAGGAAGG - Intergenic
1014109546 6:117604848-117604870 CATGTAATACAGAAGAATGAAGG + Intergenic
1014228043 6:118870780-118870802 CTGATAATACAGAAATATGAAGG + Intronic
1015481355 6:133714277-133714299 CAATTAATAGAGAATTAAGATGG + Intergenic
1015491080 6:133826126-133826148 CAATTAAGACAGAAAGAGAAGGG - Intergenic
1015733351 6:136371111-136371133 GATTAAATAGAGAAAGAGGAAGG + Intronic
1017099420 6:150834604-150834626 CATTTAATACTTAAAAAGGTGGG - Intronic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1017858730 6:158375774-158375796 TATATAATACAGAAATATGTAGG + Intronic
1018036811 6:159888874-159888896 CATTTAAGCCACAAATAGGTTGG - Intergenic
1018606600 6:165604056-165604078 TATATAACAAAGAAATAGGAAGG + Intronic
1018874449 6:167807819-167807841 CATTTAAAAAAAAAATAGGAGGG + Intergenic
1020079499 7:5279757-5279779 CATTTAATTCAAGAACAGGAGGG - Intronic
1020372086 7:7443307-7443329 CATTTAAAAAACACATAGGAAGG - Intronic
1020462955 7:8444040-8444062 GATTTGATCCAGAAATAAGACGG + Intronic
1020829530 7:13076722-13076744 CATTTAATAAAGTGATAGAAGGG - Intergenic
1021315411 7:19143442-19143464 CATTGCACACAGAAATAGGCGGG - Intergenic
1021854069 7:24836419-24836441 GTGTTAATACATAAATAGGAAGG - Intronic
1022149849 7:27591031-27591053 CATTTGATACCAAAATATGATGG - Intronic
1023212229 7:37818799-37818821 GAATTAATGCAAAAATAGGATGG - Intronic
1023627095 7:42126884-42126906 CCTGTAATCCAGAAACAGGAAGG - Intronic
1026353437 7:69537113-69537135 TATTTAAAAAAGAAAAAGGACGG + Intergenic
1027509705 7:79065038-79065060 AATACAGTACAGAAATAGGAAGG - Intronic
1027821605 7:83052850-83052872 TGATTAATACAGAAATATGAAGG - Intronic
1028947203 7:96593543-96593565 CATTTACTATAGCAAGAGGAGGG - Intronic
1030351360 7:108491457-108491479 CCTTTAATAAAGGGATAGGATGG - Exonic
1030577449 7:111307070-111307092 CATTTTCTACACAAATAAGATGG + Intronic
1030690743 7:112529920-112529942 CATTTAATACAGAACTCAAATGG - Intergenic
1031540537 7:122989667-122989689 CATTTAGGCCAGAAGTAGGAAGG + Intergenic
1031666253 7:124486417-124486439 CATTTAAGACAGGAATAGACTGG + Intergenic
1032182406 7:129691654-129691676 AAATTAATAAAGAAATAGGGTGG - Intronic
1034047410 7:147944315-147944337 CTTTTAAAACATAAATAGCATGG + Intronic
1035549675 8:511129-511151 CATTTAATATTGAATTAGTAGGG - Intronic
1035898601 8:3433097-3433119 CGTTTTATACAGAGATTGGAAGG + Intronic
1036539402 8:9689849-9689871 CATTTAATAATTACATAGGAGGG - Intronic
1036576383 8:10031493-10031515 CATCTAATCCAGATATAGGTAGG + Intergenic
1037195094 8:16179190-16179212 AATTTAATAGAGTAAAAGGAAGG + Intronic
1037705964 8:21315399-21315421 CTTTGAATTCAGAAAAAGGAGGG - Intergenic
1037929453 8:22869200-22869222 CATTTACAACATAAATAGGATGG - Intronic
1038617449 8:29107868-29107890 CTTTTCTGACAGAAATAGGAAGG + Intronic
1040711216 8:50191526-50191548 CCTCTAATACAGAATTATGAGGG + Intronic
1041361712 8:57061613-57061635 CATTTAAAACAGAACCAGGTGGG - Intergenic
1041410570 8:57549770-57549792 CAATTAATTTAGAAATGGGAAGG + Intergenic
1042017749 8:64335243-64335265 ACTTTAATGCAGAAATAGCATGG - Intergenic
1042653797 8:71072584-71072606 CATTTTTTACAAAAATAGGAGGG - Intergenic
1043387446 8:79762425-79762447 CATATAATACAAAAATATGCTGG + Intergenic
1043570250 8:81594909-81594931 CATTTAATTCCTAAATAAGATGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1044248193 8:89975583-89975605 CAGTTAACACCGAATTAGGAGGG + Intronic
1044439983 8:92211995-92212017 CATTTAAAACATAAAAAAGATGG + Intergenic
1046223042 8:111240236-111240258 CCTATAATACAAAAATAGGATGG - Intergenic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1046410396 8:113834329-113834351 CATTTTATAGAAGAATAGGAAGG - Intergenic
1048032967 8:130650417-130650439 CATGTAACTCAGGAATAGGAAGG - Intergenic
1049130452 8:140835471-140835493 TATTTAATTTAGAAATAGTATGG + Intronic
1049996421 9:1038970-1038992 CATTTATTAAAGATTTAGGATGG - Intergenic
1050065959 9:1759702-1759724 CATTTAATTAAGTAATAGAAAGG + Intergenic
1050343894 9:4667139-4667161 CATCTAATAGAGAAAAATGAAGG + Intergenic
1051130783 9:13857823-13857845 CATTCATTACAGAAATAACAAGG - Intergenic
1051305968 9:15709993-15710015 TATATAATACAGAAATAGCTGGG - Intronic
1051865927 9:21682634-21682656 TATTTAATACAGAAAATGGGTGG - Intergenic
1055479362 9:76694477-76694499 TATTTAAAACAGAATTAGGCCGG - Intronic
1056090232 9:83198202-83198224 CATATAATTTAGAAATAAGAAGG + Intergenic
1058534184 9:105938549-105938571 GATTTTATATAGAAATAAGAAGG - Intergenic
1059733608 9:117080197-117080219 CATTTAAAAAAGAAATATGTAGG - Intronic
1061191513 9:129085285-129085307 CCTTAAATACAGGAAAAGGAAGG - Exonic
1187137028 X:16557865-16557887 TATATAATACAAAAATAGTAAGG - Intergenic
1188206900 X:27371500-27371522 CATATAAAACAGACATATGAAGG + Intergenic
1188939399 X:36218370-36218392 CATTTAATGAAAAATTAGGAGGG - Intergenic
1189160196 X:38803329-38803351 CATTTAACAGAGAAATGGGGAGG - Exonic
1189189043 X:39080908-39080930 CATTGAAAACAGAAAAAGCAGGG - Intergenic
1189892585 X:45620683-45620705 CATTTCTTACAGAAATGGGTAGG + Intergenic
1190164882 X:48065203-48065225 CATTTAAGAAGGAAATAGGCCGG + Intronic
1190368047 X:49716212-49716234 CATTTATTTCAGAGAAAGGAAGG - Intergenic
1193126205 X:77873023-77873045 CATTTAATAGAGAATTATGAAGG + Intronic
1194238724 X:91417333-91417355 AATTTAATTAAGACATAGGAAGG + Intergenic
1194414653 X:93595924-93595946 GATTTAATTAAGAAAGAGGAAGG - Intergenic
1194984115 X:100471640-100471662 GATGAGATACAGAAATAGGAAGG + Intergenic
1195280576 X:103329225-103329247 CATGGAAAACATAAATAGGATGG + Intergenic
1195669817 X:107460166-107460188 CATTTAAGGCAGAAAGAAGAGGG + Intergenic
1196473462 X:116055627-116055649 CATCTAAAACAGAATTAAGAGGG - Intergenic
1197086683 X:122485035-122485057 AATTAAGTACAGAAATAGGCCGG + Intergenic
1198594122 X:138217551-138217573 AATTTATTGGAGAAATAGGAGGG - Intergenic
1198927636 X:141816296-141816318 CATTCAGTCCAGAAATATGATGG + Intergenic
1201465122 Y:14271933-14271955 TATTTACCACATAAATAGGAGGG + Intergenic
1202088106 Y:21160471-21160493 AATTTGTTACAGAAACAGGAGGG - Intergenic