ID: 925070430

View in Genome Browser
Species Human (GRCh38)
Location 2:962551-962573
Sequence AAAAATAATTAGATGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1001
Summary {0: 1, 1: 1, 2: 5, 3: 93, 4: 901}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925070428_925070430 0 Left 925070428 2:962528-962550 CCATATGAGCCTCTGCAATGCAG 0: 1
1: 1
2: 0
3: 7
4: 152
Right 925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG 0: 1
1: 1
2: 5
3: 93
4: 901
925070429_925070430 -9 Left 925070429 2:962537-962559 CCTCTGCAATGCAGAAAAATAAT 0: 1
1: 2
2: 3
3: 39
4: 421
Right 925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG 0: 1
1: 1
2: 5
3: 93
4: 901
925070427_925070430 28 Left 925070427 2:962500-962522 CCAGTTGCTGGAGTAGCTGCATT 0: 1
1: 0
2: 1
3: 9
4: 141
Right 925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG 0: 1
1: 1
2: 5
3: 93
4: 901

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925070430 Original CRISPR AAAAATAATTAGATGAAGTA AGG Intronic
900222486 1:1516710-1516732 AAAAATAATAATATGAAACAAGG - Intronic
900253725 1:1685581-1685603 AAAAATAATTAAATCAACAAGGG + Intronic
900383528 1:2397975-2397997 AAAAATAAATAAATAAATTAAGG - Intronic
900807419 1:4776548-4776570 AAAAATAAAAAGATAAAATAGGG + Intronic
901712097 1:11123782-11123804 AAAAATAAATAACTAAAGTAAGG - Intronic
902486986 1:16754538-16754560 AAAAAAAATTAGACGAGGAATGG - Intronic
902648568 1:17821519-17821541 AAAAATAATTAAATGGAGAAAGG - Intronic
903046761 1:20570115-20570137 ACAAATAAATAGATGAATGAGGG - Intergenic
903114391 1:21166746-21166768 TAAAATAAATAAATGAATTAAGG + Intronic
903619859 1:24690140-24690162 AGAATTAATGAGATGCAGTAAGG - Intergenic
904132621 1:28286447-28286469 AAAAATAATTAGTTGCATAACGG - Intergenic
904546336 1:31276142-31276164 TACATTAATTAAATGAAGTAAGG - Intronic
905038930 1:34936634-34936656 AAAAAGAATTAGGTCAAGTGTGG + Intergenic
905487549 1:38314084-38314106 AGAAATAAATAGGTGAAGCATGG - Intergenic
905613523 1:39376701-39376723 GAAAAAAATTAGCTGAATTAGGG - Intronic
907008522 1:50941000-50941022 AAAAATACTTGGATGCAGTTTGG + Intronic
907561105 1:55388518-55388540 AAAAGTAATAAAAAGAAGTACGG - Intergenic
907610379 1:55863785-55863807 AGAAATGATTAGATTTAGTAAGG + Intergenic
907952032 1:59192747-59192769 AAAAATAATAAGATGTAAAAGGG + Intergenic
908125875 1:61029829-61029851 AAAAAGAAGAAGAAGAAGTATGG + Intronic
908496588 1:64700632-64700654 TAAAATAAAAAGATGAATTAGGG - Intergenic
908632538 1:66125462-66125484 AAAAGTAATTAAAACAAGTAAGG - Intronic
908872451 1:68629490-68629512 AAGAATAATTAGGTAAAGCAGGG - Intergenic
908953500 1:69591752-69591774 AACAAGAATCAGATGAAGCAAGG + Intronic
909097500 1:71306398-71306420 AATAATAATTAGAATAACTAAGG + Intergenic
909257404 1:73441022-73441044 ATAAATACTAAGATGAAGAAAGG + Intergenic
909542762 1:76809040-76809062 AAAAATAAATAAATGAAAGATGG - Intergenic
909559038 1:76989270-76989292 AAAAAAAAATAGAAGAATTAAGG - Intronic
910157848 1:84240536-84240558 AATAATAAATAGATAAAATAGGG - Intergenic
910176528 1:84436689-84436711 AAAAATGAATAGAGGAAGGAAGG + Intergenic
910215196 1:84837012-84837034 AAAAAAAAATTGATAAAGTAAGG - Intronic
910328723 1:86043506-86043528 AAAAATAAAAAGAAGAAGTTTGG - Intronic
910332343 1:86089071-86089093 AAACATAATTGGATGATATATGG - Intronic
910417865 1:87020514-87020536 TAAAATAATTAAATTAAGAATGG - Intronic
910534588 1:88282550-88282572 AAAAATAGTTACATAAATTAGGG + Intergenic
910552571 1:88493161-88493183 AAAAATAAGTAGGTGATATAAGG + Intergenic
910564975 1:88633528-88633550 AAAAATAATAAGAGAAAGAAAGG - Intergenic
910636259 1:89411703-89411725 AAAAAAAAATAAATGAAGAAAGG - Intergenic
911313914 1:96332687-96332709 AAAAATAAGTATGTGAGGTAAGG - Intergenic
911328777 1:96501197-96501219 ATAAATAAATAAATGAAGAAAGG - Intergenic
911336450 1:96586256-96586278 CAAAATATTTAAATGATGTATGG + Intergenic
911542182 1:99170887-99170909 AAAAAGAATTAGATAAATGAGGG - Intergenic
911769178 1:101717499-101717521 CAAAATAATTAGAATAAGTAGGG - Intergenic
911770211 1:101731607-101731629 AAAAATAAATAAATAAAGAATGG - Intergenic
911805125 1:102196893-102196915 AAATATAATTAGATAAACAAAGG + Intergenic
911820265 1:102410477-102410499 AACACTAATTAGCTGAGGTATGG + Intergenic
912054199 1:105574729-105574751 AAAAATCATTACATTAAGTAAGG - Intergenic
912197133 1:107411442-107411464 AAAAATATTTGGATGCTGTATGG - Intronic
913087215 1:115450080-115450102 AAAAATAATTAGAGGTAAAAAGG + Intergenic
913301500 1:117374780-117374802 ACAAGTAATTTTATGAAGTAGGG + Intronic
913422302 1:118684505-118684527 AAAAATGATTATATAAATTATGG + Intergenic
914261501 1:146002977-146002999 AAAAATAAATAGATAAAGCTGGG - Intergenic
914264542 1:146027188-146027210 AAAAATAATTAAATGAGGTTGGG - Intergenic
915071305 1:153271581-153271603 AGAAATAATTTGATGAAACAAGG - Intergenic
915143831 1:153782976-153782998 AAAAAAAAACAGATGAACTAGGG + Intergenic
915200450 1:154222945-154222967 AAAAAGATTTAAAGGAAGTAGGG - Intronic
915747895 1:158179166-158179188 AAAAATAATTATATGACTCATGG - Intergenic
916142019 1:161708172-161708194 AAAATGAATTAGATGAGGCAGGG - Intronic
916702605 1:167313554-167313576 AAAAACAATTCAATGGAGTAAGG + Intronic
916773931 1:167939771-167939793 ATAAATAAATAAATAAAGTATGG + Intronic
917413002 1:174779694-174779716 AATATTAATCAAATGAAGTAAGG - Intronic
917760001 1:178146431-178146453 AAAAATAATTAGAGAAATTTTGG + Intronic
917817914 1:178729262-178729284 AAAAATAAATAAATAAAGCAAGG - Intronic
917912210 1:179661245-179661267 AAAAATAATTTGAAGAAATATGG - Intronic
918110929 1:181454742-181454764 GAAAATACTTAGAGGAACTAAGG - Intronic
918657442 1:187045887-187045909 AAAAATGAATAAATGAAGTGAGG + Intergenic
918809449 1:189096646-189096668 AAATATCATTAGATGAAAAAAGG - Intergenic
918941431 1:191003661-191003683 AAAAATAATCACATGGAGAATGG + Intergenic
918971552 1:191426438-191426460 AAAAATAATAAGAAGAACCATGG - Intergenic
918981316 1:191563310-191563332 AAAAATGATTAGATTATGAATGG + Intergenic
919043995 1:192428246-192428268 AAAGAGAATTAAATGAAATACGG + Intergenic
920770613 1:208881551-208881573 TAAAATATTTAAATGAGGTAAGG + Intergenic
921038794 1:211409014-211409036 AAAAATAAAGAGAAGAAGTCTGG + Intergenic
921827474 1:219689558-219689580 AAAAATAAATAAAAGAAGAAAGG + Intronic
921871827 1:220149303-220149325 AACAATAATAAGCTGAAGTATGG - Exonic
923384211 1:233450333-233450355 ATAAATAAAAAGAGGAAGTAGGG + Intergenic
924048549 1:240057470-240057492 ACAAATAAATAGAGGAAATATGG - Intronic
924246001 1:242085819-242085841 AAAAATAATGAAATGAATTTTGG + Exonic
924596629 1:245450803-245450825 AAAAATAAAGAGATATAGTATGG + Intronic
924613260 1:245590924-245590946 AAAAAAAATTGGATGACGTTGGG + Intronic
924670653 1:246120946-246120968 AAAAATGACTACATGAAGGATGG + Intronic
1062781493 10:214236-214258 AAAAGTAATTATTTAAAGTAAGG + Intronic
1063630398 10:7728342-7728364 AAAAATAAATAATAGAAGTAGGG - Intronic
1063717739 10:8545289-8545311 AAAAAGAATAAGAAGAAGGAAGG - Intergenic
1063717806 10:8545899-8545921 AAAATCAATTAGATGATATAGGG - Intergenic
1064110703 10:12536259-12536281 TAAAATAAAGACATGAAGTATGG - Intronic
1065037112 10:21650823-21650845 AAAAAAATTTAGATAAAGTTAGG - Intronic
1065988686 10:30984051-30984073 AAAAATAATTAAATGCAATATGG - Intronic
1066553009 10:36580444-36580466 AGAAAGAATTAGAGGAAGTGTGG + Intergenic
1067499081 10:46786049-46786071 AAAAATAAATAAATAAAATAAGG - Intergenic
1067595561 10:47554324-47554346 AAAAATAAATAAATAAAATAAGG + Intergenic
1067951053 10:50738995-50739017 AAAAATAAATAAATAAAATAAGG - Intergenic
1068138517 10:52975055-52975077 AAAAATAAATAAATAAGGTAAGG - Intergenic
1068444573 10:57104857-57104879 AAAAATAACCAGAAGAGGTATGG - Intergenic
1068515951 10:58025657-58025679 AAAAAAAAAGAAATGAAGTAAGG + Intergenic
1068594116 10:58883902-58883924 AAAAAGGATTAGATGAGGTAGGG + Intergenic
1068759241 10:60689399-60689421 AAAAATAAATAGATAAATAAAGG + Intronic
1068826383 10:61444761-61444783 ACAAATAAGTTGATGGAGTAAGG + Intronic
1069516239 10:69079629-69079651 AAAAAAAAAAAGATGGAGTATGG + Intergenic
1070415346 10:76184020-76184042 AAAAAAAAATAAATAAAGTAGGG - Intronic
1070674521 10:78403199-78403221 AAAAATAAATAAATAAAGGAGGG + Intergenic
1070868783 10:79729349-79729371 AAACATCATGAGATGTAGTATGG + Intergenic
1070886410 10:79904207-79904229 AAAAATAAATAAATAAAATAAGG - Intergenic
1071204889 10:83263126-83263148 AAAAAAAATGAGATTAAGTTGGG + Intergenic
1071226180 10:83531081-83531103 GAAAATAATTAAATAAAGAATGG + Intergenic
1071246126 10:83766034-83766056 AAAAGTAATTAATTGAAGGAGGG - Intergenic
1071344175 10:84675744-84675766 CAAAATAATGAGATCAATTATGG - Intergenic
1071453957 10:85827681-85827703 AAAAAAAAAAAGATGAAGAACGG + Intronic
1071635697 10:87251568-87251590 AAACATCATGAGATGTAGTATGG + Intergenic
1071659545 10:87486408-87486430 AAACATCATGAGATGTAGTATGG - Intergenic
1071762142 10:88620227-88620249 AAAAATAATTAAATGTAATGTGG + Intergenic
1072117702 10:92379762-92379784 AAAAATAAATTGATGCAGTGGGG - Intergenic
1072185728 10:93037130-93037152 AAAAAAAAGTAGAAGAAGAAAGG - Intronic
1072776946 10:98207230-98207252 CAAAATAATGCTATGAAGTAGGG - Intronic
1073270537 10:102259235-102259257 AAAAATATTTAGAAGAAGAATGG - Intronic
1073844684 10:107541500-107541522 AAAAATAATCACATGAAATTTGG - Intergenic
1074054428 10:109909273-109909295 AAAAATAAATAAATAAAGTATGG + Intronic
1074063801 10:109994202-109994224 AAAAAAAGTAAGGTGAAGTAGGG - Intergenic
1074426007 10:113352028-113352050 AAAAAAAATTAGAAGTAATAAGG + Intergenic
1075158911 10:120005445-120005467 AAAAATAAATAAATGAAGTGAGG - Intergenic
1075373537 10:121958290-121958312 AAAAATAAATAAATAAAGTAAGG + Intronic
1075573937 10:123564864-123564886 AAAAAAAATCAGATAAAGTGAGG + Intergenic
1075672794 10:124274759-124274781 AAAAAAAATTTGGTGAACTATGG - Intergenic
1075987671 10:126801617-126801639 ATGGATAATTAGATAAAGTATGG - Intergenic
1076269436 10:129138289-129138311 AAACATATTTATATTAAGTATGG + Intergenic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078762978 11:14266322-14266344 AAAAATAAATAAATAAATTATGG + Exonic
1078962161 11:16289177-16289199 AAAATCAGTTACATGAAGTAAGG + Intronic
1079154892 11:17937040-17937062 AAAAATAATCACATAAATTATGG + Intronic
1079466654 11:20737103-20737125 AAAAATAAATAAATAACGTAGGG - Intronic
1079623175 11:22580574-22580596 ACAATGAATTAGATGAATTAGGG + Intergenic
1079746302 11:24135808-24135830 AAATAAAAGTAGATGAAGGAGGG - Intergenic
1080109811 11:28553859-28553881 AAAATTAATGAGAAGAATTAGGG - Intergenic
1081059332 11:38453581-38453603 AGAAATAATTAGAAAAAGTGGGG + Intergenic
1081139384 11:39478550-39478572 ATAAATATTTAGAGGAAGAATGG - Intergenic
1081996811 11:47370710-47370732 AATAATAATTAAAAGAAATATGG + Intronic
1082565284 11:54670170-54670192 AAAAATAAATAAATAAAATAAGG - Intergenic
1083400636 11:62420987-62421009 ATAAAAAATAAAATGAAGTAGGG + Intronic
1083458326 11:62794009-62794031 AAAAATAATAAAATAAAATAAGG + Intronic
1083518911 11:63288356-63288378 AAAAATAATAAGGTCAAGTATGG + Intronic
1085204934 11:74725880-74725902 ATAAATAAATAGAGAAAGTATGG - Intronic
1085275819 11:75299454-75299476 AAAAAAAAGTAAGTGAAGTAGGG + Intronic
1085983304 11:81751187-81751209 AAAAATAATTAGAATAAAAATGG + Intergenic
1086573944 11:88316491-88316513 ATAAATAAATAAATGAAGCAGGG + Intronic
1086759158 11:90605353-90605375 AAAAAGAAGTAGATGAATTGAGG - Intergenic
1086780485 11:90898580-90898602 GAAAATAATCAGATAAATTAAGG + Intergenic
1086850983 11:91808155-91808177 AAAAAAAATTAGTAGAAGGAAGG - Intergenic
1087357841 11:97117418-97117440 ATGAATAAGTAGGTGAAGTATGG + Intergenic
1087570763 11:99924874-99924896 AAACAGAATTTGAAGAAGTAAGG + Intronic
1087595570 11:100250358-100250380 AAAAATAAATAAAGGAAGAAAGG - Intronic
1087808978 11:102589828-102589850 AATAAAAATAAGATGAAATAGGG - Intronic
1088158114 11:106834042-106834064 AAAAATAAATATGTGAAATATGG - Intronic
1088473990 11:110216363-110216385 AAAAAAAATTAGAAAAAGTTTGG - Intronic
1088695728 11:112364349-112364371 GAAGATAAATAGATGAAGGAGGG + Intergenic
1089359768 11:117877924-117877946 TAAAATAATTAGATCATCTAGGG - Intergenic
1089830260 11:121321167-121321189 AGAAATAATTGGTTGAAGGAAGG + Intergenic
1089860398 11:121585191-121585213 AAATATACTTAGATCAGGTATGG + Intronic
1089929308 11:122293744-122293766 AAAAATAATTAGGGGGAGTGAGG - Intergenic
1090148760 11:124358817-124358839 AGAAATAATGAGATGAGGGAAGG - Intergenic
1090209662 11:124909310-124909332 AAAAATAAATAAATTAAGTAGGG - Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1090880394 11:130827615-130827637 AAAATTACTTAGATCATGTAGGG + Intergenic
1090923136 11:131225012-131225034 AAAATAAATTAGATGAAGAGGGG + Intergenic
1091405252 12:204662-204684 ACAAAGAAGAAGATGAAGTAGGG + Exonic
1091729981 12:2873539-2873561 AAAAATAAATAAATGAAGAAGGG - Intronic
1092516565 12:9220740-9220762 ATAAATAATGAGATGAACTAAGG - Intergenic
1092658053 12:10708134-10708156 GAAAATAATTATATGATGGAGGG - Intronic
1092859435 12:12707711-12707733 AAAAATAAATAAATAAAATATGG - Intergenic
1093570225 12:20658735-20658757 AAAAAGATTTAAATGAAGGAAGG - Intronic
1093737678 12:22640145-22640167 AAAAATTATGTGATGAGGTAAGG + Intronic
1093960240 12:25264755-25264777 AAAAAAATCTAGGTGAAGTAAGG + Intergenic
1094761215 12:33535517-33535539 AAAAATAATTACATCTATTAAGG - Intergenic
1095880821 12:47134358-47134380 AAAAATAATTGAAGGAAGAAAGG - Intronic
1095886677 12:47195501-47195523 AAAGATAATCAGAGGAAGGAGGG - Intronic
1096062026 12:48709616-48709638 AAAAATAATAAAGGGAAGTATGG + Intronic
1096481170 12:51942049-51942071 AAGAATAAATAGATGATGGACGG + Intergenic
1096958867 12:55556849-55556871 AAAAATAAAAAGATTAAATAGGG + Intergenic
1097006608 12:55923580-55923602 AAAACTAATGAAATGATGTATGG + Intronic
1097217127 12:57422987-57423009 AAAAATATATAAATGAAGAATGG + Intronic
1097403884 12:59164357-59164379 AAAACTAAGTACATGAAGAAAGG + Intergenic
1097447967 12:59696948-59696970 AGAAATAAATTGATGAACTATGG + Intronic
1097571866 12:61343063-61343085 AAAAATAATTAAAGAAAATAGGG + Intergenic
1097634220 12:62102754-62102776 AAAAATACTAAGATGTATTACGG + Intronic
1097802937 12:63934849-63934871 AAAAAAAATGAGGTGAGGTAGGG - Intronic
1097899964 12:64862810-64862832 AAAAAAAATTACATGAATGAGGG + Intronic
1097914868 12:65010312-65010334 AAAAAGAACTAGAGGAAGTTGGG + Intergenic
1098052607 12:66470423-66470445 AAAAAAAAGTAGGTGAAGGAAGG - Intronic
1098208070 12:68133826-68133848 AAAAATAATTCAATGAAATTAGG - Intergenic
1098246408 12:68523422-68523444 AAAAATTATAAGAAGAAGCAGGG - Intergenic
1098318437 12:69216041-69216063 AAAAATAAATAGATGCAGTGAGG - Intergenic
1098393568 12:69994905-69994927 AAAAATAATTTCATAAAATACGG - Intergenic
1098668181 12:73191349-73191371 AAAAAAAAGTAGATGAATTTAGG + Intergenic
1098899669 12:76099938-76099960 ATAAATAAATAAATAAAGTAGGG + Intergenic
1099281161 12:80648200-80648222 AAATATAATGAAATGAACTAAGG - Intronic
1099381967 12:81965797-81965819 CAATAAAATAAGATGAAGTATGG + Intergenic
1099614311 12:84914801-84914823 AACAATAAATAGATGAAGAATGG + Intergenic
1099718661 12:86332359-86332381 GAAAATAATAAAATGAAGAACGG + Intronic
1099774692 12:87110359-87110381 TAAAAGAATCAGATGAAATAAGG - Intergenic
1099807517 12:87538510-87538532 AGAAATAATGAGAAGAAATATGG + Intergenic
1100234607 12:92648145-92648167 AGACATAATATGATGAAGTATGG + Intergenic
1101273905 12:103178267-103178289 AAAAATTATTAAAAGAAGTTGGG - Intergenic
1101334411 12:103783668-103783690 AAAATTAATTATATGAGGTGTGG - Intronic
1101525796 12:105528599-105528621 ACAAATAATTAAATTAAGAAGGG - Intergenic
1101907532 12:108838933-108838955 GAAGAAAATAAGATGAAGTAAGG - Intronic
1102037207 12:109778092-109778114 AAGAATACTTAGATGATTTAAGG - Intergenic
1102137649 12:110588532-110588554 AAAAATAATAAGAAGAATTTAGG + Intergenic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1102452704 12:113053701-113053723 AAAAATAAAAAGAGGAAGGAAGG + Intergenic
1103178679 12:118888307-118888329 AAAAATAATGACAGGAAGTATGG + Intergenic
1103307106 12:119973893-119973915 AAAAAAAAAGAGATGAAGGAAGG + Intergenic
1103498814 12:121384399-121384421 AAAAAAAAAAAGTTGAAGTAGGG + Intronic
1104233971 12:126913730-126913752 AAAAATTATTAGGTGTATTATGG - Intergenic
1105293482 13:19069677-19069699 AAAAATATTTACATCAAATATGG + Intergenic
1105502580 13:20985743-20985765 AAAAATAAATAAATAAAATAAGG + Intronic
1105526171 13:21179622-21179644 AAAAATAAATAGCTGAAAGATGG + Intergenic
1106223090 13:27763055-27763077 AAAAATAACAATATGAATTAAGG + Intergenic
1106238315 13:27885160-27885182 AAAAATAATTAAATGGAAAAAGG + Intergenic
1106484689 13:30161663-30161685 AAAAAAAAGTAAATGAAGTAAGG + Intergenic
1106692983 13:32138957-32138979 AGAAATAATTAGGCAAAGTAAGG + Intronic
1106988215 13:35381956-35381978 AAAACTAAATTGATGAAGAATGG + Intronic
1107851945 13:44579007-44579029 ATAAATAAATAAATGAAGTCCGG - Intergenic
1108036922 13:46299723-46299745 ATAAACAATGAGAAGAAGTAAGG + Intergenic
1108088511 13:46820921-46820943 ATAAATAATTACATCAAGTAGGG + Intergenic
1108279375 13:48846155-48846177 AAAAATAAATAAATAAAATAAGG - Intergenic
1108906934 13:55487684-55487706 AAAAATAATTAGAAAAATAAAGG - Intergenic
1108928924 13:55790099-55790121 AAAAATAATAAAATAAAATAAGG - Intergenic
1108942156 13:55969744-55969766 ACAGATAATTAGATAAAATATGG + Intergenic
1108993725 13:56697819-56697841 AAAAAAAAATAGATGAGGTTTGG + Intergenic
1109408824 13:61937957-61937979 AAAAAGAATTTCATTAAGTATGG - Intergenic
1109419642 13:62094688-62094710 AAAAATAATTAGATTACATATGG + Intergenic
1109423457 13:62143654-62143676 AAAAATAATTAATACAAGTATGG + Intergenic
1109518844 13:63482334-63482356 AAATATATTTTTATGAAGTAAGG - Intergenic
1110240732 13:73263624-73263646 TAAAATAATGATAAGAAGTATGG + Intergenic
1110557212 13:76873620-76873642 AAAAAGAAATAGAGGAAGAATGG - Intergenic
1110839759 13:80128346-80128368 GGAAGGAATTAGATGAAGTAGGG + Intergenic
1111012540 13:82330198-82330220 AAAAATAAGTAAATGAATGAGGG + Intergenic
1111034665 13:82656806-82656828 AAAAATAAATGAATGAAGGAAGG + Intergenic
1111197422 13:84893242-84893264 AAAAATAATTTGTTGAGGTGTGG - Intergenic
1111393996 13:87639637-87639659 AAAATTATTTAGTTGAAGAAAGG - Intergenic
1111405991 13:87807282-87807304 AAAACTAATCAGATGACTTAGGG + Intergenic
1112150656 13:96758251-96758273 ATAAATAAATAGATTCAGTATGG - Intronic
1112151474 13:96769284-96769306 AAAAATAAATAAATAAAGTCAGG - Intronic
1112980631 13:105380513-105380535 AAAAATCATAAGATGTAGTTTGG - Intergenic
1113140022 13:107137163-107137185 AAAAAAAAAAAGATAAAGTAAGG - Intergenic
1113311075 13:109133679-109133701 AAAGTCAATGAGATGAAGTAGGG - Intronic
1113407810 13:110057532-110057554 AAAAATAATTCGGTGAGGGAAGG - Intergenic
1114791343 14:25661917-25661939 AAAAATCACTAGAAGAAGAATGG - Intergenic
1114940996 14:27610464-27610486 AAAATTAATTATCTAAAGTAAGG + Intergenic
1115212700 14:30983545-30983567 AAAAATAAATAAATAAAATAAGG + Intronic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1116164416 14:41314862-41314884 AAAAATAATTTGAGCTAGTAGGG + Intergenic
1116214808 14:42000587-42000609 AATAATAATATGAGGAAGTATGG + Intergenic
1116279057 14:42878409-42878431 AAAAATAAGTAAATGCAGTAAGG - Intergenic
1116780245 14:49228864-49228886 AAAAATATTTGGATGAAGAAGGG + Intergenic
1116891832 14:50276411-50276433 AAAAAGAATTAGGTAATGTATGG - Intronic
1117016640 14:51525247-51525269 AAAAATAAATAAATAAAGAAGGG - Intronic
1117047754 14:51829834-51829856 AAAAAAAAAAAGAAGAAGTAGGG - Intronic
1117157419 14:52954435-52954457 AAGAATAATTAGATTAGGTTGGG + Intergenic
1117896442 14:60492470-60492492 AATAAAAAATAAATGAAGTACGG + Intronic
1118695226 14:68378180-68378202 AAAAGTAATTAGGTTGAGTAGGG - Intronic
1119189391 14:72670105-72670127 AAAAAAAAATAGAAGAAATACGG + Exonic
1119289876 14:73487226-73487248 AAGAAAAATGAGATGAATTAGGG + Intronic
1119760882 14:77150872-77150894 AAAAATTATTAGAACAAGTGAGG + Intronic
1119818480 14:77592582-77592604 AAAAATAAGTAGATTAAAAATGG - Intronic
1119914873 14:78388887-78388909 AAAAATGATGAATTGAAGTATGG - Intronic
1120990621 14:90373853-90373875 AAAAACAGTTAAATGAAATAAGG - Intergenic
1121059155 14:90887804-90887826 AAAAAAAATTAGCTGGGGTATGG + Intronic
1121181108 14:91929742-91929764 AAAAATAGACAGATGAACTAGGG + Intronic
1121370499 14:93354055-93354077 AACGATAAATAGATGAAGAATGG + Intronic
1121379366 14:93449274-93449296 AAAAATAATCAGCTTAAATATGG - Intronic
1121756279 14:96405336-96405358 AAAAAAAATTAGCTGGGGTATGG - Intronic
1121825866 14:97008914-97008936 AAAAATAAATACATAAAATAAGG + Intergenic
1121855339 14:97264332-97264354 AAAAAAAAATAGAAAAAGTATGG - Intergenic
1121968763 14:98336608-98336630 AAAATTTATTAACTGAAGTAAGG - Intergenic
1122332384 14:100931367-100931389 AAAAATAATTAAATCAGGTATGG - Intergenic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1123960576 15:25395438-25395460 AAAAAAAATAAAATGAATTATGG + Intronic
1124112961 15:26809206-26809228 AAAAAAAAAAAAATGAAGTATGG + Intronic
1124352270 15:28965232-28965254 AAAAGTAATTCCATGAAGGAGGG - Intronic
1124576270 15:30911688-30911710 AAATACAATTAGATAAAGAAAGG - Intronic
1124582896 15:30977225-30977247 ATAAATAATGAGAGGTAGTATGG - Intronic
1125333746 15:38607118-38607140 AAAAGTAGTTTGATGAAGAAAGG + Intergenic
1126379257 15:48029287-48029309 AAAAAAAATTACATGTAATATGG - Intergenic
1126610873 15:50528262-50528284 AAAAGTAATTATGTGCAGTATGG - Intronic
1127001529 15:54513786-54513808 AAAAATATTTAGAAAAAGAAAGG - Intronic
1127303494 15:57680373-57680395 AACAAAGATTAGATGAAGGAGGG - Intronic
1127568001 15:60212455-60212477 GAAAAAAATAAGATGAAATAAGG + Intergenic
1128957105 15:71959853-71959875 AAAAAAAAAAAGATGAAGTATGG + Intronic
1129500562 15:76033420-76033442 AATAATGGTTATATGAAGTAAGG - Intronic
1129501563 15:76043981-76044003 AAAAAAAATTAGTTCATGTATGG - Intronic
1129649596 15:77473928-77473950 AAATAAAAATGGATGAAGTAAGG - Intronic
1130414987 15:83684918-83684940 AAAAATTATTAGGTAAAATATGG + Intronic
1130437656 15:83918030-83918052 AAAAATGATTAGAAGTATTAAGG - Intronic
1130549734 15:84882511-84882533 AAAAAAAATTAGCTGGCGTATGG + Intergenic
1130630773 15:85566953-85566975 AAAAATAATTTGTACAAGTAAGG + Intronic
1130958155 15:88641614-88641636 AAAAATAAAAAGAGGAAGTTTGG - Intronic
1130992520 15:88884569-88884591 ATAAATAAATAAATAAAGTAGGG + Intronic
1131376660 15:91930081-91930103 AAAATTAAAGAGATGAATTATGG - Intronic
1131466743 15:92661534-92661556 AGAAATAATTAGATCAAAAAAGG + Intronic
1131906870 15:97152460-97152482 AAAAATAATGATATGAACTGAGG + Intergenic
1133122059 16:3614989-3615011 AAAATAAATTAGTTGAAGTGTGG + Intronic
1133534676 16:6690049-6690071 AAAAATAAATAAATAAAGCAAGG - Intronic
1134402061 16:13919600-13919622 AAAAAAAATTAAAAGAAGGATGG + Intergenic
1134904197 16:17965483-17965505 AAAAATAATTAAATGAAAGCAGG - Intergenic
1135083983 16:19459930-19459952 AAAAAAAAATAGAAGAGGTAGGG + Intronic
1135227843 16:20676824-20676846 AAAAATAAATAAATAAAATAAGG + Intronic
1136094699 16:27946687-27946709 AGAAAGAATTAAATGAAGCAAGG + Intronic
1136153923 16:28369848-28369870 AAAAATAAATAAATAAAATAAGG + Intergenic
1136209168 16:28745416-28745438 AAAAATAAATAAATAAAATAAGG - Intergenic
1136225015 16:28854459-28854481 AAAAATAATAAGGCCAAGTATGG + Intronic
1137652401 16:50131742-50131764 AAAAATAAATAAATAAAATAAGG + Intergenic
1138571268 16:57874862-57874884 AAAAATAAATAAATTAAATAAGG + Intergenic
1138909248 16:61376569-61376591 AAAAATAAGTAGATAAAGCAGGG - Intergenic
1138928459 16:61621537-61621559 ACAAATAAATAAATGAAGAAAGG + Intergenic
1139019597 16:62730939-62730961 AAGAATAAATAAATAAAGTATGG - Intergenic
1139054045 16:63159422-63159444 AATAAGAACAAGATGAAGTAAGG + Intergenic
1139127420 16:64095947-64095969 CAAAAGCATTAGATGAAGCAGGG + Intergenic
1139153040 16:64407614-64407636 AAATATAATTAGTTGTAGTGTGG + Intergenic
1139362740 16:66411889-66411911 AAAAATAATTCAATGGAGAAAGG + Intergenic
1139451881 16:67034196-67034218 AAAAATATTTATAAGAAGTATGG + Intronic
1139575281 16:67837802-67837824 AAAAATACTGGGATGAAGTGAGG + Intronic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140052929 16:71498852-71498874 AAAAAAAAAAAGATGAAGTAGGG - Intronic
1140239905 16:73191409-73191431 AAAATTAATTAGAGGCAGTTTGG - Intergenic
1140577328 16:76186471-76186493 AAAAATAAGTATATGAGGTGAGG - Intergenic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1141746070 16:85927268-85927290 ACAAATAGTTATATGAATTATGG + Intergenic
1143075394 17:4338252-4338274 AAAAACAATTATATGAAATTAGG + Intronic
1143666792 17:8367018-8367040 GAAAATAAGTAGATGAAGGAAGG - Intergenic
1143961882 17:10728177-10728199 AAAGATATTTAGAAGATGTATGG + Intronic
1144909119 17:18665889-18665911 AAAAAAAAAAAGAAGAAGTATGG - Intronic
1145086782 17:19949361-19949383 AAAAAAAATTTAAAGAAGTAAGG + Intronic
1145278345 17:21450221-21450243 AAAATCAACTACATGAAGTATGG - Intergenic
1145316167 17:21736117-21736139 AAAATCAACTACATGAAGTATGG - Intergenic
1145401108 17:22533815-22533837 AAAATCAACTACATGAAGTACGG + Intergenic
1145714597 17:27008042-27008064 AAAATCAACTACATGAAGTATGG - Intergenic
1146178493 17:30682137-30682159 AATAATAAATAGATAAAATATGG + Intergenic
1146505040 17:33397475-33397497 GGAAATAATTAGAGGAAATATGG + Intronic
1147414215 17:40276827-40276849 AAAAATAAATAAATAAAGAATGG + Intronic
1147770252 17:42863094-42863116 AAAAAGAATTAGCTGCTGTAAGG - Intergenic
1147981293 17:44275863-44275885 AAAAATAATAAAATAAAGAAAGG - Intergenic
1148632597 17:49122964-49122986 AAAAAGTATTTGGTGAAGTAGGG + Intergenic
1149030995 17:52081816-52081838 AAAAAGATTTAGATGAAGCATGG + Intronic
1149433484 17:56613967-56613989 AAAAAAAAAAAGATTAAGTAGGG - Intergenic
1149663459 17:58349223-58349245 AAAAATCATAAGTTGAACTAAGG - Intronic
1150057537 17:62032489-62032511 AAAAAAAAAAAGATGAAATAAGG + Intronic
1150199191 17:63335687-63335709 AAAAATAACTAAATACAGTATGG + Intronic
1150271695 17:63870652-63870674 AAAAATGATTTCATGAAGTCAGG - Intergenic
1150277377 17:63908300-63908322 AAAAATGATTTCATGAAGTCAGG - Intergenic
1150895475 17:69205263-69205285 AATAAATATTTGATGAAGTAAGG - Intronic
1151862866 17:76778697-76778719 AAAAATATTTATATGACATATGG - Intronic
1152468806 17:80479421-80479443 AAAAAAAATTAGCTGAAGTGTGG - Intergenic
1152731501 17:81973872-81973894 AAAAATAAATAAATAAAATAAGG - Intergenic
1153379359 18:4419628-4419650 GAAAATAATAAGATAAAGGATGG + Intronic
1153858407 18:9173883-9173905 AAAAATAATAAGAAGAAGAAAGG + Intronic
1155741221 18:29290553-29290575 AGAAATAATTACATTTAGTAAGG + Intergenic
1155747275 18:29373087-29373109 AAAAATTAGTAAAAGAAGTAAGG + Intergenic
1156535090 18:37855087-37855109 AAAAGTAGTTAGAAAAAGTAAGG - Intergenic
1156732268 18:40208234-40208256 ACAAATAATTCGAAGAAGTGGGG - Intergenic
1156961510 18:43037338-43037360 AAAAATAATTAAATGAGATAAGG - Intronic
1157241745 18:46016363-46016385 CAAAATAAATAAATAAAGTATGG + Intronic
1157917075 18:51675568-51675590 AAAATTATTTACATGAAGTTGGG - Intergenic
1157928782 18:51796016-51796038 AAGTGAAATTAGATGAAGTAGGG + Intergenic
1158124266 18:54084088-54084110 AAATAAAATTAGATCAGGTAAGG - Intergenic
1159386848 18:67736906-67736928 AAATATAATTAGAATATGTAGGG - Intergenic
1159402790 18:67959223-67959245 AAATATCTTTAGAAGAAGTAAGG + Intergenic
1159523104 18:69551533-69551555 AACAATAATTAGAAAAAGAATGG + Intronic
1159596563 18:70388191-70388213 AAAAAAAAGAAGAAGAAGTATGG - Intergenic
1160054809 18:75469052-75469074 AAAAATAAATAAATAAATTATGG - Intergenic
1160148382 18:76382175-76382197 AAAAATAAATCAATGAAGTCAGG + Intronic
1160382013 18:78466961-78466983 ATAAATAATAAGAGGAAGAAAGG - Intergenic
1163304003 19:16465973-16465995 AAAAAAAAATAGATAAAGTGAGG - Intronic
1163427878 19:17248947-17248969 AAAAATAAATAAATAAAATAAGG - Intronic
1163490731 19:17615989-17616011 AACAATAATCCTATGAAGTAGGG + Intronic
1163999468 19:21083618-21083640 AAAAATAATTAATTAAAATATGG - Intronic
1164026894 19:21360781-21360803 AAAAATAATTAATTAAAATACGG - Intronic
1164162449 19:22636610-22636632 AAAAATAAATAAATAAAATATGG - Intronic
1164345978 19:27257604-27257626 CTAAATAATTAAAAGAAGTAAGG + Intergenic
1164657381 19:29932947-29932969 AAAAATAAATCGATGTAGTCCGG - Intronic
1164780811 19:30890496-30890518 TAATATAATTATAGGAAGTAAGG + Intergenic
1164983271 19:32630061-32630083 AAAAATAACAAGATGAAGCTGGG - Intronic
1165184935 19:34010322-34010344 TAAAAGAATTAGATCAACTAGGG + Intergenic
1165759567 19:38312945-38312967 AAAAAAAAGAAGAAGAAGTAGGG - Intronic
1166229732 19:41419428-41419450 AAAAATAAGAAGAAGAAGTCTGG - Intronic
1166839919 19:45691071-45691093 AGAAATAATTATTTGAAATAAGG - Intronic
1167380487 19:49135358-49135380 AAAAATAAATAAATAAAGTCAGG - Intronic
1167828242 19:51994944-51994966 AAAAATAAATAAATAAAATAGGG - Intronic
1168032681 19:53693334-53693356 AAAAATAATTAGGTGAATATGGG + Intergenic
1168695009 19:58399181-58399203 ATAAATAAATAAATGAAATAAGG - Intergenic
1202704220 1_KI270713v1_random:9700-9722 AAAAAAAATTAGACGAGGAATGG + Intergenic
925006885 2:450264-450286 AAAAATAATTCTATGTAGAAAGG - Intergenic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
925419123 2:3697026-3697048 CAAACTAATTAGAGGAACTATGG + Intronic
925642287 2:5997442-5997464 AAACATAATTAAAAGAATTAGGG - Intergenic
926017287 2:9465045-9465067 AAAAAGAATTAGATGAAGTATGG + Intronic
926177265 2:10605351-10605373 AAAAATAATCTTAGGAAGTAAGG + Intronic
926482311 2:13414417-13414439 AAAAATCATGAGATGAAGAACGG + Intergenic
926495237 2:13578225-13578247 AAAAATGTTTATATGAAATATGG - Intergenic
926562571 2:14434233-14434255 AAAAATACTGAGAAGAAGGAAGG + Intergenic
926916360 2:17895881-17895903 GTAAATAATTTGATGGAGTAAGG + Intronic
926993902 2:18713233-18713255 ATAAATAATTAGAGAAATTATGG - Intergenic
927349091 2:22085744-22085766 AAAAAAAATTAGATGAGGCTGGG + Intergenic
927361402 2:22238608-22238630 AAAAATAGTTATTTGATGTATGG - Intergenic
927773153 2:25881063-25881085 AAAAATAATTTGATATGGTAGGG - Intergenic
928137244 2:28696783-28696805 AAAAATAAATAAATAAAGTTTGG + Intergenic
928452869 2:31393467-31393489 AAAACTAAGTAGATAAAGAAAGG - Intronic
928640377 2:33292184-33292206 AAAAATAGTAATATGTAGTAGGG + Intronic
928663039 2:33523017-33523039 AAAAAAAATTAATTGAAGTAAGG - Intronic
928741832 2:34363722-34363744 AAAGATAATTAAATGATGTCAGG + Intergenic
929091263 2:38219384-38219406 AAACAAAATTATATGAAGGAAGG + Intergenic
929205512 2:39287728-39287750 AGAAATGATTAAATGAAATAAGG + Intronic
930165648 2:48201430-48201452 ATAAATAAATAAATAAAGTAAGG - Intergenic
930411263 2:51028405-51028427 AAAAAGAACTAGATAAAGGAGGG - Exonic
930455169 2:51599216-51599238 AAACACAATTAGAAAAAGTAAGG + Intergenic
930461566 2:51685372-51685394 AAAAGTAATTAGGTGAGGTGAGG - Intergenic
930465244 2:51739787-51739809 AAAAATGAATACATGAAGTAGGG - Intergenic
931022788 2:58068590-58068612 AAAAAACATTTGATGAAATAAGG - Intronic
931023755 2:58083457-58083479 AATAAGAATTAAATGAAGTAAGG + Intronic
931024138 2:58089604-58089626 GAAAATAAATAGATAAAATAAGG - Intronic
931098125 2:58965229-58965251 AAAAAGAAAGAAATGAAGTAAGG + Intergenic
931131669 2:59343106-59343128 GAAAATAATTCCAAGAAGTAGGG + Intergenic
931252719 2:60548545-60548567 AAAATTAATTAGGTGAAATGTGG - Intronic
931952715 2:67383079-67383101 AGAAAGAATGAGATGAAGGATGG - Intergenic
932087898 2:68778060-68778082 AAAATTAATTAAATAAATTATGG - Intronic
932209680 2:69915992-69916014 GGAAATAATTAAATGGAGTAAGG - Intronic
932254696 2:70274495-70274517 AAAAATAAAAAGTAGAAGTAAGG - Intronic
932455430 2:71846632-71846654 AAAAACAATAAGATGAAGAAAGG - Intergenic
932622302 2:73272042-73272064 AAAAGAAATTAGCTGAACTAAGG + Intronic
932989518 2:76769465-76769487 GAAAATAATTAAATGAATTTCGG + Intronic
933025174 2:77248958-77248980 AAGAAAATTTAGATGAACTAGGG + Intronic
933147006 2:78865945-78865967 AAAAATGAATGGATGAAATATGG + Intergenic
933373946 2:81454588-81454610 TAAAATAAGTGGATGAAATAAGG - Intergenic
933878347 2:86643078-86643100 AAAAATAAATAAATGTATTATGG - Intronic
935090201 2:99888523-99888545 AAAAAGAAATTGATGAAATAGGG - Intronic
935495427 2:103775314-103775336 AAAAATAAACAAATAAAGTAAGG + Intergenic
935526342 2:104172484-104172506 AAAAAAGATTAGAGGAAATATGG + Intergenic
935930291 2:108116843-108116865 AAAAATAGTTAAAAGAAATATGG - Intergenic
936026048 2:109031812-109031834 GAAAATACTTAGAGGAAGGAGGG - Intergenic
936603097 2:113919492-113919514 AAAAGTAAATATAGGAAGTAGGG - Intronic
936941998 2:117893257-117893279 AAAAAAAATTAGATGACCTTGGG - Intergenic
937805402 2:126137121-126137143 AAAAATATCTAGATGGAATATGG - Intergenic
938179796 2:129170139-129170161 AATAATATTTAGATGATGGATGG - Intergenic
939152678 2:138492091-138492113 AACAATAATTAAAAGAAGTCTGG - Intergenic
939287518 2:140152647-140152669 GAAAATAAATATTTGAAGTAGGG - Intergenic
939641566 2:144645781-144645803 AAAATTAATAAGGTGAAATATGG + Intergenic
939777003 2:146400544-146400566 AAAAACAACTAGAAGAAATAAGG - Intergenic
939797341 2:146662513-146662535 AGAAATTATTAGATTTAGTATGG - Intergenic
939865552 2:147468731-147468753 AAAAATAATTAAATGAAGGGCGG - Intergenic
940076193 2:149744637-149744659 ATAATTAATTACCTGAAGTAAGG + Intergenic
940245897 2:151615573-151615595 AAGAATAAATAGAAGTAGTAAGG + Intronic
940300723 2:152174433-152174455 AAAAAAAGTTTAATGAAGTAAGG + Intronic
940502817 2:154515503-154515525 AGAAATAATTATTTGAAGAAAGG + Intergenic
940560127 2:155284444-155284466 AAAATCAATTTGATGAAATAAGG + Intergenic
941572110 2:167183923-167183945 AAAAATAAATAAATAAATTAAGG - Intronic
941884169 2:170511553-170511575 AATGATAATTACAGGAAGTAAGG - Intronic
942422985 2:175827197-175827219 ATCAATAATTTGATAAAGTAGGG - Intergenic
942716576 2:178899873-178899895 ATAAATTATTAGATGAGGAAAGG + Intronic
942756102 2:179343426-179343448 AAAAAAAAAAAGAAGAAGTATGG - Intergenic
942815712 2:180051330-180051352 AATAATAATAAGAAGAAGAAAGG - Intergenic
942964175 2:181869915-181869937 CAAAATAATTAGAAGAATTTTGG + Intergenic
943155580 2:184170691-184170713 AACAATAAATAAATGAAGTTGGG + Intergenic
943272346 2:185822902-185822924 AAAAATCATTTGATCATGTATGG - Intronic
943405536 2:187478398-187478420 AAAAACAAATAGTTGATGTATGG + Intronic
943488021 2:188512873-188512895 AAAAATAATTATAGGAATTTTGG + Intronic
943991505 2:194699330-194699352 AAAAATAATGAGAACAATTATGG + Intergenic
944224387 2:197335436-197335458 AAAAAAAAAAAGATGCAGTAGGG - Intergenic
945274313 2:207972853-207972875 AGAAATAATTTAATGAAATAAGG + Intronic
945317902 2:208390832-208390854 AAAAAGTATTTGATGAGGTAGGG + Intronic
945523257 2:210855804-210855826 AAAATTAATTAGAAAATGTAGGG + Intergenic
945774506 2:214088209-214088231 AAAAAAAATTAGATAAAAGATGG + Intronic
945929799 2:215843272-215843294 AAAATAAATCAGATTAAGTAAGG - Intergenic
946625283 2:221605256-221605278 AAAATTAAGTACATGCAGTAAGG + Intergenic
947403127 2:229748681-229748703 AAAAAAAAATAGAAGAAGTTTGG + Intergenic
947462290 2:230313884-230313906 AAAAGTAACTATAAGAAGTATGG + Intergenic
947726577 2:232405095-232405117 AAAAAAAAATAGAGGAAGTGTGG - Intergenic
948582642 2:238998299-238998321 ATAAATAAATAAATGAAGGAAGG - Intergenic
1169034347 20:2437334-2437356 AAACATAAATAAATAAAGTAAGG - Intergenic
1169387283 20:5161667-5161689 AAAAATTATTAGGTAAATTACGG - Intronic
1169625961 20:7569752-7569774 AAAAATGATTAAATGAAGTCTGG + Intergenic
1169719108 20:8653682-8653704 AAAAATAATTATATGAGAAATGG - Intronic
1169901015 20:10551641-10551663 ATAAATAATCACATGAAGAATGG + Intronic
1170805190 20:19623565-19623587 AAAAATAATTAATTTAAGTTTGG - Intronic
1170929081 20:20752517-20752539 TAAAATAATTTGATGAAATTGGG - Intergenic
1171568915 20:26227012-26227034 AAAAATAATTATAAGAAGAATGG - Intergenic
1171999412 20:31761183-31761205 AAAAAAAATTAATTGAAGGAGGG - Intronic
1172313538 20:33935832-33935854 GAAAATAATTACATAAATTATGG + Intergenic
1172489433 20:35323366-35323388 AAAAATAACAGGATGAAGCAAGG + Intronic
1172711004 20:36923444-36923466 ATAAATAAATAAATAAAGTAAGG + Intronic
1172953492 20:38738257-38738279 AAAAATAAAAAATTGAAGTATGG - Intergenic
1173483294 20:43420621-43420643 AAAAATAATGAGAGGAAGTAAGG + Intergenic
1173633584 20:44535006-44535028 AAAAATACTTAGATATAATAAGG + Intronic
1174026610 20:47581947-47581969 AAAAATTATCAGATGAGGGAGGG - Intronic
1174184164 20:48693905-48693927 AAAAATAAATAAATAAAATAAGG - Intronic
1175430565 20:58899599-58899621 AAAAATAATTTGATAATGAATGG - Intronic
1175556600 20:59864272-59864294 AATAATAATTAGATAAAGTATGG + Exonic
1176880356 21:14184880-14184902 AAAACTAATCAGAGTAAGTAAGG + Intronic
1176897045 21:14392422-14392444 AAAAAAAATTAGATGATATAAGG - Intergenic
1176929386 21:14789884-14789906 AAGAAAAATTAGAAGAAGCAAGG - Intergenic
1177226472 21:18263780-18263802 AAAAAGAAGAAGATGAAGTAAGG - Intronic
1177786495 21:25677028-25677050 AAATAGAATTAGAGGAAGAAAGG + Intronic
1177871335 21:26576273-26576295 AAAAATTGTTAGATCAAATAAGG + Intergenic
1177887808 21:26766741-26766763 TTAAATAATTAGGTGAGGTAAGG - Intergenic
1177957770 21:27622082-27622104 AAAATTTATTAGTTAAAGTAAGG + Intergenic
1178090612 21:29159246-29159268 AAAAATAATTCCTAGAAGTAGGG + Intronic
1178217702 21:30619852-30619874 GAAAATAAATATATGAAATAGGG - Intergenic
1178276422 21:31242010-31242032 TAAAACAATTAAATAAAGTATGG + Intronic
1178547408 21:33503983-33504005 TTAAAAAAATAGATGAAGTAAGG + Exonic
1178594150 21:33937593-33937615 AAAAAAAAAAAGAAGAAGTAGGG - Intergenic
1178700498 21:34829450-34829472 AAAAATAATTAAAGGAAAGAAGG - Intronic
1180165072 21:46021339-46021361 AAAAAAAAAAAGATGAAGTGAGG + Intergenic
1180974425 22:19839581-19839603 AAAAATAATTAGCTGGGGCAGGG + Intronic
1181091419 22:20475550-20475572 AAAAAAAATTAGAGGAAGGAGGG - Intronic
1181259904 22:21590182-21590204 AAAAATAAAAAAATAAAGTAGGG - Intronic
1182857811 22:33533713-33533735 AAAAATTAGAAGATGAAGTGGGG - Intronic
1182906787 22:33944744-33944766 AAAGAAAATTAGAAGAAATATGG + Intergenic
1183532574 22:38369136-38369158 AAACAAAATTAGATTAAGCAAGG - Intronic
1183816110 22:40302099-40302121 AAATAGAATTAGAACAAGTAAGG + Intronic
1183934103 22:41252320-41252342 ATAAATAATAAAATAAAGTAAGG + Intronic
1183937192 22:41269827-41269849 AAAAATAAATAAATTAAATAAGG - Intronic
1184579768 22:45408116-45408138 AATAATAATAAGATGAAGGAAGG - Intronic
1184807972 22:46808377-46808399 AAAAATAAAGAAATGCAGTAGGG + Intronic
949165986 3:941505-941527 ACCAATAATGAGTTGAAGTACGG + Intergenic
949177398 3:1081747-1081769 AAGAATTATAAGATGAAATAAGG - Intergenic
949214744 3:1552387-1552409 AAAAATAAATAAATAAATTAGGG + Intergenic
950108963 3:10406259-10406281 GAAAAGAATGAGATGAAGTGTGG + Intronic
950607028 3:14091169-14091191 AGACATAATTAGAAGATGTAGGG + Intergenic
951099963 3:18676065-18676087 AAAAATAATGTGATTAAGTAAGG - Intergenic
951323338 3:21273295-21273317 AAAAATCCTGAGATGAACTAGGG + Intergenic
951393445 3:22135861-22135883 AAAAACAATTAAATAAAGAAAGG + Intronic
951684414 3:25328531-25328553 AAAAATAAATAAGTGAAATAAGG + Intronic
951901246 3:27659719-27659741 AAAAATAACAAAAGGAAGTAGGG - Intergenic
952270586 3:31827206-31827228 AAAAATAATTAGGTGAAGCCAGG - Intronic
952584075 3:34870100-34870122 AAAAAAAAAAAGATGAATTAAGG - Intergenic
952724745 3:36572188-36572210 AAAATGATTGAGATGAAGTAGGG - Intergenic
953950307 3:47184489-47184511 AAAAATAATAATAAGAAGAAAGG - Intergenic
953968634 3:47329909-47329931 AAAAAAAATTAGAGGAAGAAAGG - Intronic
955225858 3:57060015-57060037 AAAAATAAATAGATGAAGTGAGG + Intronic
955977562 3:64492811-64492833 AAAAATGATGAGGAGAAGTATGG - Intergenic
956223425 3:66928687-66928709 AAAAATTATTAGATCTAGTGAGG + Intergenic
956576185 3:70755496-70755518 AAAAATCATTTGTTGAACTAAGG + Intergenic
956590924 3:70913897-70913919 CAAAATAATGAAATGATGTAAGG + Intergenic
956594730 3:70954100-70954122 AAAAATAATTAGATGCATTTAGG - Intergenic
956601488 3:71027476-71027498 AAATGTAATTACATAAAGTAGGG - Intronic
956610664 3:71119384-71119406 AAAAGAAATTAGAAGAAGGATGG - Intronic
956630589 3:71312991-71313013 AAAAATAATAAAATAAAATAAGG + Intronic
957109934 3:75941340-75941362 AAAAATAATTATAAGAAGAATGG + Intronic
957233705 3:77555973-77555995 AAAACTAATTAGATGACCTTTGG + Intronic
957272010 3:78042514-78042536 AAAAATATTTAGAACAAGTTAGG + Intergenic
957290372 3:78270748-78270770 AAAGAAAATTGGATGAAGTTTGG - Intergenic
957309532 3:78501913-78501935 AAAAAAAATTAAATGAACAACGG + Intergenic
957677164 3:83383164-83383186 AAAAAAAATTATTTGAGGTAAGG + Intergenic
957883472 3:86252718-86252740 AAAAATAATTTGTCCAAGTAGGG - Intergenic
957984463 3:87555790-87555812 ATAGATCATTAGATGAAATAAGG + Intergenic
958000320 3:87741256-87741278 AGAAATAATTAGTGGTAGTAAGG - Intergenic
958144585 3:89607363-89607385 AAAAATGATTATATCAAGTTAGG - Intergenic
958579034 3:95991922-95991944 AAAAATAAAAAGATGTAGGAGGG + Intergenic
958875057 3:99606491-99606513 ATAAATAATTAAATAAAGAACGG + Intergenic
958981986 3:100732111-100732133 AATAATAATTATAGGAACTAAGG - Intronic
959246275 3:103873493-103873515 ATAAATATTTAAATTAAGTATGG - Intergenic
959364404 3:105438870-105438892 TAAAATAAATAAATGAAGGAAGG + Intronic
959429305 3:106232948-106232970 AAAATTAATGAAATGAAGTTTGG + Intergenic
959687657 3:109165141-109165163 ATAAATAAATAAATAAAGTATGG + Intergenic
960119463 3:113932539-113932561 AAAATCAATTGAATGAAGTAAGG - Intronic
960146999 3:114214119-114214141 AAAAATAAATAAATGAATTCTGG - Intergenic
960747229 3:120903552-120903574 ATAACTAATTAGATGTAGTAAGG - Intergenic
961133521 3:124490236-124490258 AATAATAATAAGAAGAATTAAGG + Intronic
961186872 3:124922821-124922843 AAAAATGATTACATCAAGGAAGG - Intronic
961802134 3:129459516-129459538 AAAAAAAAATAGATGTAGTCAGG - Intronic
962141555 3:132795593-132795615 AAAAAAAACTGGGTGAAGTAAGG - Intergenic
962239018 3:133734576-133734598 AAAACTAAACAGATGAAGAAAGG + Intergenic
962413644 3:135162920-135162942 ACAAATAATTACATAAACTATGG - Intronic
962543141 3:136403336-136403358 AAAATTAATGAGATGATGTCAGG + Intronic
962805320 3:138922993-138923015 AAAAATAAATAAATGAAAAAGGG - Intergenic
962904288 3:139788143-139788165 AAAAAAAATTACATGCAGTAAGG - Intergenic
963213301 3:142717787-142717809 AAAAAAAATAAGAGGAAATACGG + Intergenic
963835002 3:150049229-150049251 TAAAATAATTAGATGGTGAATGG + Intronic
963951244 3:151204430-151204452 AATAATAATTATATGAATTTGGG - Intronic
964074475 3:152676493-152676515 AAAAATAAATAAATGAAGGATGG + Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964269751 3:154942334-154942356 AAAAATAATAATAAGAAGAAAGG + Intergenic
964465801 3:156990599-156990621 ATAAATAAATAGATGAAGGTAGG - Intronic
964518205 3:157535261-157535283 AAACATAATTAGTTGAATTGGGG + Intergenic
964560239 3:157987247-157987269 AAAAAAAATAACATGAAGAATGG + Intergenic
964588340 3:158332922-158332944 AAAAATGATTAAATAAATTATGG - Intronic
964779356 3:160318506-160318528 ATTAATAATTAGTTGAAGAAAGG - Intronic
964969526 3:162542361-162542383 GAAAATAAAGAAATGAAGTAGGG - Intergenic
965068272 3:163880961-163880983 AAAAATATATATATTAAGTATGG - Intergenic
965147025 3:164918827-164918849 GAAAATATTTAAATAAAGTAAGG - Intergenic
965371314 3:167865214-167865236 AAAAGTAATTTAATCAAGTAAGG - Intergenic
965544246 3:169899101-169899123 ATAATTAATTAGATTAAGTTTGG - Intergenic
965582009 3:170278658-170278680 ATAAATAAATAAATGAAGGAAGG + Intronic
965777929 3:172253257-172253279 AATATTAATAAGATGAAGCAGGG + Intronic
966600715 3:181772713-181772735 AATAATAATGATATGAAGTCTGG + Intergenic
966616699 3:181921202-181921224 AAAAGGAATTTGATCAAGTAAGG - Intergenic
966633208 3:182102204-182102226 AGAAATTATTAAATGTAGTAAGG - Intergenic
966682099 3:182652778-182652800 AAGAATGATTAGATTAATTATGG - Intergenic
966950185 3:184810175-184810197 AAAAGAAATTAGCAGAAGTAGGG - Intergenic
967021040 3:185523057-185523079 AAAAAGTATTAAATGAATTATGG - Intronic
967123375 3:186403595-186403617 AAAAAGAAGTAAATGAAGTCGGG - Intergenic
968695124 4:2020902-2020924 AAAAATAAATAAAGGAAGGAAGG - Intronic
969838398 4:9862076-9862098 AAAAAGAAGTAGATGCAGGAAGG + Intronic
969991348 4:11266701-11266723 AAAGATAATAAGATGAAAAATGG - Intergenic
970002505 4:11378477-11378499 AAAAATAATAATAGTAAGTAGGG + Intergenic
970333975 4:15013491-15013513 AAAACTAAATAGAAGAACTAAGG - Intronic
970352724 4:15219968-15219990 AAAAATAAATCAATGAAGAAAGG + Intergenic
970372332 4:15420586-15420608 AAAAATATCCAAATGAAGTAAGG - Intronic
970488827 4:16551482-16551504 ATAAATAGATAGTTGAAGTAAGG - Intronic
970781990 4:19748605-19748627 AAAAAGAAGGAGATGAAGCAAGG - Intergenic
970797574 4:19931870-19931892 GAAAATAATTTGATGATCTAAGG + Intergenic
970870832 4:20814960-20814982 ATAAATTATTAGATGAATAAAGG - Intronic
970935085 4:21559982-21560004 AAAATGAAATAGATCAAGTAAGG - Intronic
971213936 4:24646326-24646348 AAAACTAATTAGAGCAAGTGTGG - Intergenic
971583375 4:28372561-28372583 ACAAATAATTGGATAAAGTGTGG + Intronic
971730935 4:30378991-30379013 AAAACTACTAAGATGAAGAATGG + Intergenic
971761405 4:30770912-30770934 AAAAATAGTTACAGAAAGTAAGG - Intronic
971783915 4:31075797-31075819 AAAAATAATAAAAGGAAGGAAGG - Intronic
971879189 4:32346946-32346968 AAACATTATTAAAAGAAGTATGG + Intergenic
972105054 4:35474064-35474086 AAAAAAAATGATATGAAGAAAGG - Intergenic
972105593 4:35481589-35481611 AGAAATAAATAGATAAAGAAGGG - Intergenic
972228919 4:37047779-37047801 AAAGATCATAAGATGAAGGAAGG - Intergenic
972469806 4:39393101-39393123 AAAATTAATGAGATGAAAGATGG + Intergenic
972550527 4:40128841-40128863 AAAAATAAATAAATAAAATAAGG + Intronic
972693491 4:41422213-41422235 AAAAATAAATAAATAAAATAAGG - Intronic
972953600 4:44360841-44360863 AAACATAAGTAAATGAAATAAGG - Intronic
973537600 4:51899217-51899239 AAAAATAAATAAATGAACTCAGG + Intronic
973727961 4:53794577-53794599 AGAAATGAATAGATGAAGTGCGG - Intronic
974422800 4:61699445-61699467 AAATAAAATAAGATGAAGTTAGG + Intronic
974528008 4:63070482-63070504 AAAATTAATTAAATTATGTACGG + Intergenic
974713611 4:65636505-65636527 AAAAAAAATGAGATTCAGTATGG - Intronic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975110672 4:70619435-70619457 AAAAATGATTAGATGATGTCTGG + Intergenic
975184656 4:71387479-71387501 ATAAATAAATACTTGAAGTAGGG - Intronic
975604951 4:76145356-76145378 AAAAAAAAGTAGTTGAATTAGGG - Intronic
975954689 4:79823644-79823666 AAAAACAAATTGAAGAAGTATGG - Intergenic
975959787 4:79888393-79888415 AAAAATTATAACATGCAGTATGG - Intergenic
976526052 4:86090215-86090237 AAAAATAAACAGAAGAATTAGGG + Intronic
976567700 4:86570699-86570721 GAAAATAATAACTTGAAGTAAGG + Intronic
976705071 4:88011613-88011635 AATAAAAATTACATAAAGTATGG - Intronic
976782735 4:88778926-88778948 ATAAAGAACTAGAGGAAGTAAGG - Intronic
976974344 4:91148418-91148440 AATACTAATTAAATGAAGGAGGG - Intronic
977018050 4:91718978-91719000 AAAAATAATTATCTTAAGCATGG + Intergenic
977202089 4:94129543-94129565 CAAAATACTTAGGTTAAGTAGGG + Intergenic
977295356 4:95203230-95203252 GAAAAGAATTAGATAAATTAAGG + Intronic
977633807 4:99272510-99272532 ATAAATAAATAAATAAAGTAGGG - Intergenic
978567126 4:110095137-110095159 AAAAACAAATAGAGGAAGAATGG + Intronic
978631803 4:110756172-110756194 AAAAGTATTGAGATGAAGGAGGG + Intergenic
978813263 4:112874981-112875003 AAAAATGCTTAGATGAATGAAGG + Intronic
978987297 4:115029021-115029043 AAAAATAATTCTATGTAGAAAGG + Intronic
979168211 4:117564031-117564053 AAAAATATTTAGATGATATATGG + Intergenic
979833444 4:125330207-125330229 AAAAAAAAATACTTGAAGTATGG - Intronic
979902725 4:126243508-126243530 AAAAATAAATAAATAAAGTCAGG - Intergenic
980008822 4:127572155-127572177 AAAATCAATTAGAGGAAGTCAGG - Intergenic
980193018 4:129549766-129549788 AAAAATAAATAAATAAATTAGGG + Intergenic
980267286 4:130533785-130533807 AAAAATAGTTAGATGAGGTATGG - Intergenic
980327553 4:131367865-131367887 AAAAATAATAAGAAGAAGAAAGG - Intergenic
980630796 4:135429811-135429833 AAAAATAAGTAGCTAAAATAAGG + Intergenic
980665578 4:135929333-135929355 AAAAATAATGAGATCATGTCAGG - Intergenic
980705007 4:136481976-136481998 AAAAATATTTATATGAAGGAAGG - Intergenic
980803058 4:137777678-137777700 AAAAATAATTAGATAAACTGAGG - Intergenic
981433115 4:144685676-144685698 AAAAAAAAATAGAAGAAGGAAGG + Intronic
981494639 4:145377583-145377605 TAAGAAAATAAGATGAAGTAAGG - Intergenic
981673555 4:147314917-147314939 AAAAATATCTAGCTGAAGAAAGG - Intergenic
981807311 4:148731712-148731734 AAAAATAATTATATTTAGAAAGG - Intergenic
981990874 4:150919021-150919043 ACAAATGATTAAATAAAGTATGG + Intronic
982028086 4:151272186-151272208 AAAGATAAATAGATAAAATACGG + Intronic
982145866 4:152391106-152391128 AAAATTATATAAATGAAGTATGG - Intronic
982338425 4:154267413-154267435 AAAAATACTTGGATGAGGAAAGG - Intronic
982578428 4:157146838-157146860 AAAAAAAATTAGATGATGGGTGG + Intronic
982689695 4:158534027-158534049 ATAAATAATTGGAAGGAGTAAGG + Intronic
982964299 4:161883780-161883802 TAACATCATTAGATGAATTAAGG - Intronic
982967353 4:161929220-161929242 AAAGCTAATTAAATGAAGAAAGG - Intronic
982981648 4:162144724-162144746 AAAGAGAATTAGGTGAAATATGG + Intronic
983676623 4:170302159-170302181 TCAAATAATTCTATGAAGTAGGG - Intergenic
983703658 4:170630826-170630848 AGAAATAATTCAATGAAGTAAGG - Intergenic
984085953 4:175311524-175311546 AAAAAAAATGAGATGTAATAAGG + Intergenic
984201749 4:176730215-176730237 ACAAATAATCATATGAAGAAAGG + Intronic
984740299 4:183155039-183155061 AAAAACAATGAGAGGAAGGAGGG + Intronic
984798400 4:183688620-183688642 AGAAATGATTAGATGAAGCTGGG + Intronic
984801345 4:183719734-183719756 AAAAAAAAAAAGATGAAATACGG + Intergenic
984969798 4:185177861-185177883 AAAAATAAATAAAGTAAGTATGG + Intronic
985172945 4:187171900-187171922 AAAAATAATAATAGAAAGTAGGG + Intergenic
985981740 5:3475302-3475324 AAAAATAATTATGTGATGAAAGG - Intergenic
986479575 5:8172801-8172823 AAACATAAATGGCTGAAGTATGG + Intergenic
986497583 5:8361195-8361217 AAAAACAGTTATATGAAGCATGG + Intergenic
986823723 5:11497754-11497776 GAAGATAATTATATGATGTAGGG + Intronic
987227799 5:15861920-15861942 ATAAACAATTAAATGAAGTCTGG - Intronic
987636627 5:20551100-20551122 AATAATAAATAGATGAACGAAGG + Intronic
988024920 5:25673372-25673394 AAAAATTATGATATGAAGTGAGG + Intergenic
988231052 5:28479799-28479821 AAAAATAATGGAAAGAAGTAAGG - Intergenic
988252304 5:28774986-28775008 AAAATTATTTAGATAAATTAGGG - Intergenic
988350693 5:30103105-30103127 AAAAAGAATTATTTGAAATAAGG - Intergenic
988379691 5:30484360-30484382 AATAATAATTAAATAAAGAATGG - Intergenic
988454078 5:31372213-31372235 AAAAACAATCAGAAGAAGAAGGG - Intergenic
988788373 5:34584792-34584814 TAAAATACTTAGAAGAAGTTTGG + Intergenic
988889240 5:35596853-35596875 AAAAATTATTAGAAGAAGCTGGG + Intergenic
989516160 5:42346692-42346714 AAAAATAAGTAAATAAAGTGCGG + Intergenic
989795020 5:45458280-45458302 AAAAATAATTTAATGATGGAAGG + Intronic
990310815 5:54536194-54536216 AAAAATAATTATTTAAAGTGAGG - Intronic
990731600 5:58814713-58814735 AACAGTAACTAGATGAAGCAAGG - Intronic
991093136 5:62712071-62712093 AAAAATGATTGGCTGAAGTGTGG + Intergenic
991258750 5:64644228-64644250 AAAGAAAATTAGATGAATTAAGG + Intergenic
991569591 5:68040387-68040409 AAAAATAATAAAATGAAAGAGGG + Intergenic
992172255 5:74115017-74115039 CAAGATAATGAGATCAAGTATGG + Intergenic
992341313 5:75826336-75826358 AGAAATAATTGCATGATGTAAGG - Intergenic
992499958 5:77332243-77332265 AAAAATTAAAATATGAAGTAAGG - Intronic
992948707 5:81835094-81835116 AAAAATAAAGAGATGAAGGAAGG + Intergenic
993325532 5:86530860-86530882 AAAAATTTTTAGATGAAATCTGG + Intergenic
993382391 5:87222579-87222601 AAAAATAACTAAATAAATTAAGG + Intergenic
993563122 5:89437116-89437138 CAAAATAATTAGATATATTATGG - Intergenic
993696857 5:91071651-91071673 AAAAATAAATAAATAAAATAAGG - Intronic
993972689 5:94439428-94439450 GAAACTAATTAGGAGAAGTATGG + Intronic
994023755 5:95058649-95058671 AAAAATAAATGGAAGAGGTATGG + Intronic
994248284 5:97506360-97506382 ACAAATAATTAGCTGGGGTATGG + Intergenic
994271697 5:97784882-97784904 AAAAATAGTTAGAATAAGTGAGG - Intergenic
994290279 5:98021728-98021750 AAATATAATTAAATGAACTGAGG - Intergenic
994311044 5:98271267-98271289 AAAAATAACTAGAAGAACTTTGG + Intergenic
994335119 5:98555767-98555789 GAAGATAATTAGATGAAGCTAGG + Intergenic
994414257 5:99448360-99448382 AACAATAAATAGAAGAGGTAAGG + Intergenic
994941571 5:106330131-106330153 AAATTTAATTAAATGAAGCATGG + Intergenic
995274005 5:110257786-110257808 AAAAATATTTAAATGATGAAGGG - Intergenic
995962089 5:117854074-117854096 AAAAATAATTGAAAGAAGAAAGG + Intergenic
995981804 5:118113374-118113396 AAATATATTTAGTTAAAGTAAGG - Intergenic
996313178 5:122130045-122130067 AAAGAAAAGTAGATGAAGTCAGG + Intronic
996537054 5:124588812-124588834 GAAAATAACTAGATAAAGTAAGG - Intergenic
996876246 5:128243534-128243556 AAAAACAATGCGAGGAAGTATGG + Intergenic
997037445 5:130209712-130209734 AAAAATAAATGTATGAAGAAAGG - Intergenic
997152590 5:131514609-131514631 AAAAACAATTAGAGGAAAAATGG + Intronic
997193008 5:131957188-131957210 AAAAACAATTACATGAGTTAGGG + Intronic
997545600 5:134704504-134704526 TAAAACAATTAAAAGAAGTAGGG + Intronic
998179270 5:139925098-139925120 AAACATATTCAGATGAAGTAGGG + Intronic
998288492 5:140887699-140887721 AAAAACTATTAGAAGAAGTATGG - Intronic
998398524 5:141835368-141835390 ATAATTAATTAGAAGAACTATGG - Intergenic
998672506 5:144369405-144369427 AATACAAATAAGATGAAGTAGGG + Intronic
999160497 5:149492459-149492481 AAAAATAAATAAATAAAGTAAGG + Intronic
1000596245 5:163218238-163218260 AAAAAGAATTGCAGGAAGTAGGG + Intergenic
1000620111 5:163475099-163475121 AAAAATAATTTTATGTAATATGG + Intronic
1000834675 5:166139301-166139323 AAATAAAATTAGAAGAAGAAAGG + Intergenic
1001330438 5:170758727-170758749 AAAAAAAAATAGATAAAGTATGG - Intergenic
1001632972 5:173190303-173190325 AAAACTACTGAGATGAAGAACGG + Intergenic
1002621867 5:180494051-180494073 AAAAAGAAGTAGATGAAAAATGG + Intergenic
1003320701 6:5048680-5048702 AAAAGTGATGAGGTGAAGTAGGG - Intergenic
1003962215 6:11219393-11219415 AAAAATAATCAGAGGAAGCCGGG - Intronic
1004340806 6:14805886-14805908 AAAAAGAACTAGAAGAAGAAGGG + Intergenic
1005382297 6:25248674-25248696 TAAAACAATTAAATGAAATATGG + Intergenic
1005394307 6:25365547-25365569 AAAAATAAATAAATAAAGTGAGG - Intronic
1005429367 6:25738300-25738322 AAAAACAATTTAATGAAGGAAGG + Intergenic
1005861222 6:29903235-29903257 AAAAACAATTCAATGAAGGAAGG + Intergenic
1006200641 6:32286843-32286865 AAAAATAAATATATGATGTCAGG + Intergenic
1006260516 6:32865296-32865318 AAAAATGAAGAGATAAAGTATGG + Intergenic
1006568483 6:34980337-34980359 AAAAATTTTTAAATGAAATAAGG - Intronic
1006700676 6:35970671-35970693 AAAAATAATCAGAAGAATTTTGG - Intronic
1006971695 6:38051971-38051993 AAAAAAAATTATTTGGAGTAAGG - Intronic
1007045233 6:38766718-38766740 AAAAATAACTATGTGAAGTGAGG + Intronic
1007942577 6:45796177-45796199 AATAATAGATAGCTGAAGTATGG - Intergenic
1008010643 6:46464060-46464082 AAAAACAAGTAAATGAATTATGG + Intronic
1008102376 6:47405782-47405804 GAAAAGAATTAGATGAATTCTGG + Intergenic
1008152552 6:47972103-47972125 AACAATAATGAGATGATGTAGGG + Intronic
1008607002 6:53150283-53150305 AAAAAAAAAAAGATGAAGCAGGG - Intergenic
1008892950 6:56517064-56517086 AAAAATAATTAGTTTAAATAAGG - Intronic
1008973593 6:57399017-57399039 AAAAATAATTAAATAAATAAAGG - Intronic
1009826755 6:68875753-68875775 AAAATTATTTACTTGAAGTAAGG - Intronic
1010117669 6:72334176-72334198 AAAAATAAGTAATTGAATTATGG - Intronic
1010130722 6:72490522-72490544 CAAAATAATTAAAAGAAATATGG + Intergenic
1010374134 6:75146760-75146782 AAAAATAATTGGAAGCAATATGG - Intronic
1010510498 6:76712666-76712688 AAAAAAAAAATGATGAAGTAAGG + Intergenic
1010926103 6:81748463-81748485 TAAAAAAATTAAATGAAGGAGGG - Exonic
1011489500 6:87875723-87875745 AAAAATAAATAAATAAAGTGGGG - Intergenic
1011543256 6:88456350-88456372 AAAAATTATAAGATGACGTGTGG + Intergenic
1011635172 6:89365663-89365685 AAAAATAATTCTATGACATAGGG - Exonic
1011800895 6:91015248-91015270 AAAAATTATTAAATGAAATAAGG - Intergenic
1011894102 6:92202308-92202330 AAAAATATGTAGCTGAAGCAGGG + Intergenic
1011974428 6:93277492-93277514 AAAAATAAGTACAGGAACTAAGG + Intronic
1012566833 6:100666482-100666504 AATAATAATTATATAATGTATGG - Intronic
1012827771 6:104166904-104166926 GAAAATAATAAGATGAATTTTGG + Intergenic
1012832469 6:104222067-104222089 AAAAAAAGTTAGAAAAAGTAGGG - Intergenic
1013043283 6:106457986-106458008 AATAATAATTACATGTGGTAAGG + Intergenic
1013175926 6:107676405-107676427 GAAAAATATTAGATGAAGTCAGG + Intergenic
1013427794 6:110030265-110030287 AAAACTAATTAGATGGGGAAAGG - Intergenic
1013677004 6:112476353-112476375 AAAGATTATTACATGAAATATGG + Intergenic
1013682200 6:112537012-112537034 AAAAAAAAAAAGAAGAAGTAAGG - Intergenic
1014042408 6:116844122-116844144 AAAAATAATAAAATAAAATAAGG + Intergenic
1014368418 6:120574563-120574585 ATAAATAATTAGAAGAAACAAGG + Intergenic
1014411474 6:121127822-121127844 AAAAATAATTACATTATGTTTGG - Intronic
1014515567 6:122374376-122374398 TAAAATAATTAGATGAAAATGGG - Intergenic
1014716770 6:124874747-124874769 AAAAACAATTAAGTGAAGGAAGG - Intergenic
1014857015 6:126415423-126415445 ATATATCATTAAATGAAGTAGGG + Intergenic
1014936846 6:127395447-127395469 AACAATAATTAGAGCAAGAAAGG - Intergenic
1015177925 6:130331420-130331442 AAAAATAAATACATAAAGTTTGG + Intronic
1015219647 6:130789505-130789527 ATAAATAAATAAATAAAGTAAGG + Intergenic
1015545213 6:134354920-134354942 AAAAGAAAATAGAAGAAGTAAGG - Intergenic
1015649414 6:135438881-135438903 AAATTTAATTATTTGAAGTAAGG + Intronic
1015657154 6:135531848-135531870 AAAAATAGTAAGATCAATTATGG - Intergenic
1015773973 6:136794586-136794608 AATAATAATTAAAGGAAGGAAGG + Intergenic
1016707579 6:147129473-147129495 CAAAATGATTAAATGAATTATGG + Intergenic
1017080141 6:150660597-150660619 CAAAATAATTTCATTAAGTATGG + Intronic
1017277467 6:152586525-152586547 AAAAATAATTAGAAGTGGTATGG - Intronic
1017693039 6:156986394-156986416 AAAAATAATTAGACAAACTTTGG - Intronic
1017755903 6:157528935-157528957 AAGCATAATTAGATGAAGACTGG + Intronic
1018056063 6:160053433-160053455 AATAATAATAAAATGAATTAAGG + Intronic
1018085332 6:160296581-160296603 AAAAATAAAAATATGAAGCAAGG - Intergenic
1018362170 6:163082018-163082040 AAAAACAATTAGATCCAGTAAGG + Intronic
1018374380 6:163197013-163197035 ATAAATAAATATATGAAGGAGGG + Intronic
1020236252 7:6357965-6357987 AAAAATAAATAAATAAATTATGG - Intergenic
1020270981 7:6595665-6595687 AAAAAAAATTAAAGAAAGTATGG - Intronic
1020523794 7:9231041-9231063 AGATATATTTATATGAAGTATGG + Intergenic
1020601896 7:10286016-10286038 AAAAATATTTATTTAAAGTAAGG + Intergenic
1020714977 7:11662027-11662049 AAAAATAATCAGAGAAAGAAAGG + Intronic
1021130312 7:16904094-16904116 AAAAATAATTCAATGTATTATGG - Intergenic
1021146918 7:17100208-17100230 AAAAAGAATTAAATGAAGACTGG + Intergenic
1021263526 7:18490044-18490066 GAAAATAATTAGACTAGGTAAGG - Intronic
1021317349 7:19165240-19165262 AATAATAAGTACATGAAGAAAGG + Intergenic
1021342525 7:19481839-19481861 AAAAATAATTAAATCATCTAAGG - Intergenic
1021443950 7:20712439-20712461 AAAAATACTTAGATAAATAATGG - Intronic
1021540792 7:21755368-21755390 AAAAATTATTGGGTGAACTAAGG - Intronic
1021836451 7:24680953-24680975 AAAATTAATTAGATGTAGTTAGG + Intronic
1022594427 7:31698748-31698770 AAATCTAGTTAGATGAAGAATGG + Intronic
1022652233 7:32287814-32287836 AATACTAATTAGATGACGTGAGG + Intronic
1022810852 7:33867484-33867506 AAAAATAATAAGAAAAAGTTTGG + Intergenic
1022878507 7:34562036-34562058 AACAATGATTAGATGAAGATAGG + Intergenic
1022967043 7:35483490-35483512 AAAAATAATTGGAGAAAGGAAGG - Intergenic
1023277771 7:38539057-38539079 AAAAATCATTATTTGAAGAACGG + Intronic
1023319822 7:38982680-38982702 AACAACAATTAGATGAACTTGGG + Intronic
1023326529 7:39065389-39065411 AAAAATAATGAGAGAATGTAAGG - Intronic
1023336378 7:39175010-39175032 AAAAGTAATTTGATGATGGAGGG - Intronic
1024133704 7:46384599-46384621 AAAAAAAATTAAAAAAAGTAGGG + Intergenic
1024390417 7:48805037-48805059 AAAAAAAAAAAGAAGAAGTAAGG + Intergenic
1025192915 7:56909978-56910000 AAAAATAAATAAATAAAATAAGG + Intergenic
1026827699 7:73594542-73594564 AAAAAAAAAAAGAAGAAGTAGGG - Intronic
1027386760 7:77666597-77666619 AAAAATAAAAAGAAGAAATATGG - Intergenic
1027714909 7:81658310-81658332 AAAAATAATTAAAAGAAGACAGG + Intergenic
1028287442 7:89020872-89020894 ATAGATAATTAAATGAAGTCAGG - Intronic
1028295119 7:89119951-89119973 AAAAATATTTAGATAAAAAAAGG - Intronic
1028334760 7:89638245-89638267 ATAAATAAATAAATGAAGTAAGG - Intergenic
1028830606 7:95323263-95323285 AAAAATATATAGATAAAGGATGG - Intronic
1029660356 7:101956472-101956494 AAAAAAAATCAGATGGATTATGG + Intronic
1030327121 7:108232046-108232068 ATAAATAATTAGATGAACTCAGG + Intronic
1030516645 7:110546859-110546881 GAAAATAATAAGATGCAATAGGG + Intergenic
1030613338 7:111712494-111712516 AAAAATAAAAAGGTGAAGTAAGG - Intergenic
1030694370 7:112568836-112568858 AAAAATAATTGAATCAATTAAGG + Intergenic
1030712803 7:112771750-112771772 AAAGATAAATAGAAGTAGTATGG - Intronic
1030925351 7:115446186-115446208 AAAAATATTTACATGATGTCAGG - Intergenic
1031076075 7:117213986-117214008 AAAAATAAATAAATAAAATAGGG - Intronic
1031248960 7:119354903-119354925 AAAAGTAATTATCTAAAGTAAGG - Intergenic
1031441794 7:121803724-121803746 AAAACTCATTAGAGGAAGCAGGG + Intergenic
1031519445 7:122745682-122745704 AAGAATGAATAAATGAAGTAAGG + Intronic
1032141710 7:129337380-129337402 AAAAATAAATAAATAAATTACGG - Intronic
1032187832 7:129742568-129742590 TAAAATAAGTTGATGAGGTATGG + Intronic
1032584176 7:133131129-133131151 ATAAATAAATAAATAAAGTAGGG + Intergenic
1032617332 7:133488409-133488431 AAAAAGAAAAAGATGAAGTGAGG - Intronic
1032636746 7:133717628-133717650 AATAATGAGTAGATGAAGTGTGG + Intronic
1032668436 7:134061735-134061757 AAACAGAATTAGATGACATAGGG + Intronic
1032823964 7:135551265-135551287 AAAACCAATCAGATGAAGAAGGG + Intergenic
1033057343 7:138070347-138070369 AGAAATAATAAGATTAAGTTTGG - Intronic
1034109494 7:148522492-148522514 AAAACAAAATAGATGAAGGAAGG + Intergenic
1034289618 7:149919152-149919174 AAAAAAAATTAAATGAAACAAGG - Intergenic
1034661443 7:152773671-152773693 AAAAAAAATTAAATGAAACAAGG + Intronic
1035582641 8:749411-749433 TAAAATAATTAGGAGAAGTCTGG - Intergenic
1036090427 8:5658938-5658960 AATAATAATGACATGAAGTATGG + Intergenic
1037249715 8:16878054-16878076 AAAAATAAATTGATGAAGGCAGG + Intergenic
1037367317 8:18136575-18136597 AATTATAATTAAATGAAATATGG - Intergenic
1037432847 8:18831900-18831922 AAAAAAAAATAGAAAAAGTATGG + Intronic
1037433412 8:18838448-18838470 AAAAATAAATAAATGAAGTTGGG + Intronic
1037697636 8:21239760-21239782 ACAAATAAATAGATAAAATATGG - Intergenic
1038281040 8:26164959-26164981 AAATATAATAAGAAAAAGTAGGG + Intergenic
1038353218 8:26800395-26800417 AAAAATAATTCAATGGAGGAAGG + Intronic
1038890208 8:31713095-31713117 AAAAAAAATTAGAAGGAGTATGG - Intronic
1039250992 8:35663777-35663799 TAAAATGATTAAAGGAAGTATGG + Intronic
1039322040 8:36442963-36442985 AAAAATAATTAGAGGAGATATGG - Intergenic
1039863238 8:41477633-41477655 AAAGAGAATTAGCTGAAGTTTGG + Intergenic
1040585568 8:48737276-48737298 AAAAATAATAAAAAGATGTAGGG + Intergenic
1040738046 8:50534975-50534997 AATAATAATAAGCTGAAATAAGG - Intronic
1041452872 8:58025854-58025876 AAAAATATTTACATCAACTAGGG - Intronic
1041762426 8:61381386-61381408 AAAAATAATTAAATAAATAAAGG - Intronic
1041923016 8:63204288-63204310 AAAAATCAGTAGATTAATTAAGG - Intronic
1042288976 8:67147701-67147723 AAAAAATATTAGCTGAAGTCTGG - Intronic
1042379853 8:68100944-68100966 AAAAAACATTAGATGAATTTGGG + Intronic
1042677139 8:71333818-71333840 AAATATAATTAGTAGAAGAAAGG + Intronic
1043166506 8:76909376-76909398 AAAAATAAATAAAGGAAGTTTGG - Intergenic
1043211129 8:77519938-77519960 ATAAATGATTAGATGGAGTGAGG - Intergenic
1043485307 8:80693324-80693346 AACAGTTGTTAGATGAAGTATGG - Intronic
1043596132 8:81887683-81887705 AGAAATAATCAAATGAACTACGG + Intergenic
1043736388 8:83751016-83751038 TAAAATAATTAGATGAATCTAGG + Intergenic
1043769368 8:84179071-84179093 AAAAATACATAGAGGAAGTAAGG - Intergenic
1043818438 8:84833124-84833146 AAAAATAATTGAATTAAATAAGG - Intronic
1043984395 8:86676557-86676579 GAAGATAATTAGTTGCAGTAAGG + Intronic
1044022533 8:87123757-87123779 ACAAATTGTTAGATTAAGTAGGG + Intronic
1044034409 8:87282090-87282112 AAAAATAAAGTGATGAAGTGAGG - Intronic
1044072047 8:87773438-87773460 AAAAATAATTATATTAAAAAAGG - Intergenic
1044446311 8:92280882-92280904 CAAAATAATTAGAGAAAGAAAGG + Intergenic
1044644756 8:94427466-94427488 AAAAGTAATTAGATGAAATATGG - Intronic
1044889191 8:96814319-96814341 CAAAATAATTAGAAGAAGAAAGG - Intronic
1044970841 8:97618018-97618040 ACAATAAACTAGATGAAGTATGG - Intergenic
1045237151 8:100362681-100362703 TAAAATACTTAGAGAAAGTATGG + Intronic
1045561103 8:103263946-103263968 AATAAAAATTATATGAAGTTGGG + Intergenic
1045717409 8:105064793-105064815 AAACATAAGAAGATGAAATACGG + Intronic
1046088620 8:109470153-109470175 AAAAATATTTGGATGAAGATTGG + Intronic
1046237265 8:111441541-111441563 AAAAATAAATAGATCAACTTGGG - Intergenic
1046357012 8:113100655-113100677 AATAAAAAGTATATGAAGTAAGG + Intronic
1046399750 8:113689581-113689603 AAAAATAATAACAGAAAGTAAGG - Intergenic
1046403327 8:113737388-113737410 AAAAATAGTTACATGAATTTAGG + Intergenic
1046456412 8:114469799-114469821 AAAAATAATTAAATGAAATGTGG - Intergenic
1047084088 8:121496981-121497003 AAAGATTGATAGATGAAGTAGGG + Intergenic
1048285765 8:133140402-133140424 GAAAATAATTAGAAAATGTATGG - Intergenic
1048637943 8:136319816-136319838 AAAAAATAATAAATGAAGTAGGG - Intergenic
1048729563 8:137423285-137423307 AAAAAAAAATAGAGGAAGAAAGG - Intergenic
1048887512 8:138920192-138920214 AAAAATAAATAAATAAAGGAAGG - Intergenic
1050526648 9:6552224-6552246 AAAACTAAATAAATAAAGTAGGG - Intronic
1050994583 9:12199937-12199959 AAAAATATATAGAAGAAGGAAGG + Intergenic
1051032559 9:12699392-12699414 AAGAAAAATAAGATGAGGTAGGG - Intronic
1051166313 9:14265978-14266000 AGAACTAATTAGCTGAAGGATGG + Intronic
1051490678 9:17660807-17660829 AAAAATAAAATAATGAAGTATGG + Intronic
1051706127 9:19881993-19882015 AAGAATAGTTAAATGAATTATGG - Intergenic
1051754302 9:20379912-20379934 ACAAATAAATAAATGAAGTGAGG + Intronic
1051774182 9:20616680-20616702 AAGAATAATTAAGTGAAATAAGG - Intronic
1052099515 9:24427969-24427991 AGAAGTTATTAGATGCAGTAAGG + Intergenic
1052343709 9:27387527-27387549 AAAAATATTTAGACTATGTATGG + Intronic
1052736771 9:32350506-32350528 AAAAAGAATGGGATGAAGTTGGG - Intergenic
1052741318 9:32395495-32395517 CAAAAAACTTAGATGCAGTAGGG + Intronic
1053136717 9:35655447-35655469 ATAAATAAATAAATGAAATATGG - Intergenic
1053334619 9:37255253-37255275 TGAAATTATGAGATGAAGTAAGG + Intronic
1053588571 9:39486754-39486776 AAAAACAATTACATGGAGGAAGG + Intergenic
1054577734 9:66878540-66878562 AAAAACAATTACATGGAGGAAGG - Intronic
1054959802 9:70955344-70955366 AAAAATAATTGGATGAGACAAGG - Intronic
1055272268 9:74574512-74574534 AAAAATAAATAAATAAAGCATGG + Intronic
1055780595 9:79817192-79817214 AAAGATAACTAGATGAAATGTGG - Intergenic
1055812819 9:80169819-80169841 AAAGATAATTATATGAAGTGAGG - Intergenic
1055977189 9:81966974-81966996 AAAATAAATCACATGAAGTACGG - Intergenic
1056603031 9:88061324-88061346 AAAAAAAAAAAGAAGAAGTAGGG - Intergenic
1056614635 9:88153360-88153382 AAAAATAATTAAATGGAGGAAGG - Intergenic
1057013765 9:91632254-91632276 AAAAAAAAAAAGAAGAAGTAAGG + Intronic
1057018224 9:91673711-91673733 AAAAATAATTTGATGGAGAAAGG - Intronic
1057369916 9:94462182-94462204 AAAAATAAATAGTTTAAGGATGG - Intergenic
1058502703 9:105637516-105637538 AAAATACATAAGATGAAGTATGG - Exonic
1058523426 9:105834460-105834482 AAAAGATATTAGATCAAGTAGGG + Intergenic
1058542051 9:106021580-106021602 AAAAAAAACTAGATGACTTAAGG - Intergenic
1058674367 9:107387952-107387974 AAAAATAATAACAGGAAGGAAGG - Intergenic
1059255837 9:112929890-112929912 AAAAATAAATAAATAAAGTTGGG - Intergenic
1059593953 9:115695666-115695688 AACAACAATTAGATGAAATAAGG - Intergenic
1059860743 9:118458383-118458405 AAAAATAAATAGATGCAGATAGG + Intergenic
1060780251 9:126406821-126406843 AAAAAAAAAAAGATGAAGAAAGG - Intronic
1061279226 9:129587512-129587534 AAAAAAAATAAGATAAAGGAAGG + Intergenic
1061622113 9:131817433-131817455 AAAAATAAATAAATGAATAAGGG - Intergenic
1062471373 9:136706941-136706963 AAAAAAAAAGAGATGAAATATGG + Intergenic
1062558220 9:137126713-137126735 AAAAATTATTACATGATATAAGG - Intergenic
1062678229 9:137761010-137761032 AAAAATAAAAAGATGCACTAAGG + Intronic
1062727758 9:138086046-138086068 ATAAATAATGAGAGGAAGAAAGG + Intronic
1185452967 X:292606-292628 ATAAATAAATAAATTAAGTATGG - Intronic
1185842284 X:3403054-3403076 ATAAATAAATGGATGAAGGAAGG - Intergenic
1186058892 X:5681924-5681946 AAAAATAAGAAGAGGAAATAGGG + Intergenic
1186085894 X:5990626-5990648 AAAAAAAATTAGTTGAATAAAGG - Intronic
1186091723 X:6055725-6055747 AAAAATAATTATCTGAAAAATGG + Intronic
1186948930 X:14600483-14600505 GAAAATAATTAGATGGCATATGG - Intronic
1187057412 X:15753912-15753934 AAAAATAAATAAATGAATTTCGG + Intronic
1187710948 X:22053804-22053826 CAGAACAATAAGATGAAGTAGGG + Intronic
1187760011 X:22572295-22572317 ATAAATAATTGAATGAACTATGG + Intergenic
1187994114 X:24906744-24906766 AAAAAGAAATAGAAGATGTAAGG + Intronic
1188179925 X:27042276-27042298 AAAAGTAAAGAGATGAAGGAAGG - Intergenic
1188341098 X:29003055-29003077 AAATATAATTATAGGAAGGAGGG + Intronic
1188393775 X:29655260-29655282 AAACTTATTTAGATGAAGTTTGG - Intronic
1188899828 X:35716937-35716959 AAAAATAAGTAGGTGAGGTGAGG - Intergenic
1188902545 X:35751755-35751777 AAAAGTAATTAAATGAACAATGG - Intergenic
1188932791 X:36134514-36134536 AAAAGCAATTAAATCAAGTAAGG + Intronic
1189174186 X:38937784-38937806 AAAAATAGTTATATGAAAGAAGG - Intergenic
1189254199 X:39624688-39624710 AAAAAAACTTAGCTGAATTATGG - Intergenic
1189390185 X:40569942-40569964 TAAAATAAATAAATAAAGTATGG + Intergenic
1189561738 X:42198003-42198025 AAAAATAAGTAGGTGAAGCAAGG - Intergenic
1189932582 X:46030055-46030077 AAAAGTAAATAGATGAAACAAGG + Intergenic
1190419444 X:50214252-50214274 AAAATCAATTAAATGAAGTCTGG - Intronic
1190896835 X:54627811-54627833 AAAAATAATAAGAGGAATTTTGG - Intergenic
1191046911 X:56148272-56148294 AAGAATAATTGGAAGAATTAGGG - Intergenic
1191104705 X:56765297-56765319 AAAAAGAATAAGATGAAAAACGG - Intergenic
1192489287 X:71560293-71560315 AAGAAAAAATAGATGAACTATGG + Intronic
1192916895 X:75661360-75661382 AAAAATAATTTGATTAAAAATGG - Intergenic
1193139716 X:78014889-78014911 CAAAATGGATAGATGAAGTATGG - Intronic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193525638 X:82584744-82584766 AAATATAATTAGTTAAAATATGG - Intergenic
1193578034 X:83227991-83228013 AAAAATAATAAGAAGAAGGAGGG - Intergenic
1193608063 X:83593001-83593023 AAAAAGAATTATAAGAAGTGTGG - Intergenic
1193648445 X:84098539-84098561 AAAAATAAAGAGATGAAATGAGG + Intronic
1193798782 X:85910827-85910849 AAAATCAATTAGAGGAGGTAAGG + Intronic
1193895451 X:87109921-87109943 AAAAAAAAAAAGAAGAAGTAAGG + Intergenic
1194131696 X:90089367-90089389 AAAACTAATTATCTTAAGTAAGG + Intergenic
1194790393 X:98141097-98141119 TAAAACAATTAAATGAATTATGG - Intergenic
1194971138 X:100345540-100345562 AAAACCAATTAGGAGAAGTAAGG - Intronic
1195545908 X:106112446-106112468 AAAAAAAATTAGAAGAGGAAAGG + Intergenic
1195553608 X:106196259-106196281 AAAAATAAATAAATTATGTACGG - Intronic
1195623234 X:106980204-106980226 AAAAATCTTAAGATGAACTATGG - Intronic
1195663030 X:107400126-107400148 ATAAATAATTAAATAAAGTTAGG - Intergenic
1197429054 X:126337107-126337129 AAAAATAATTTGAGGCAGAAGGG + Intergenic
1197453408 X:126646085-126646107 AAAAATAATAAAATGAGGTAAGG + Intergenic
1197547944 X:127850553-127850575 AAAAATAATTAGAAGAATTGGGG - Intergenic
1197966670 X:132070503-132070525 AAAAATAGTTATATCAAGTTTGG - Intergenic
1198458995 X:136845874-136845896 AAAATATATTGGATGAAGTAAGG - Intergenic
1198540306 X:137631597-137631619 AAAAACAAGTGGATGAAGTTAGG + Intergenic
1198973647 X:142310122-142310144 AAAAAGAATGAGATGATGGATGG + Intergenic
1199042624 X:143131498-143131520 AAAAACAAAAAGATGATGTATGG + Intergenic
1199200462 X:145081712-145081734 AAAAGTAATAAGCAGAAGTAAGG - Intergenic
1199240304 X:145540568-145540590 AAAAATACTTAGAAGATGTAAGG + Intergenic
1200745617 Y:6901465-6901487 AAAAATAAATAAATAAAATATGG + Intergenic
1202104589 Y:21349488-21349510 AAAAAGTATTAGGTAAAGTAGGG + Intergenic