ID: 925072855

View in Genome Browser
Species Human (GRCh38)
Location 2:984661-984683
Sequence GCACATCCTGCCATCATCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925072852_925072855 -1 Left 925072852 2:984639-984661 CCTGAAATTGCTCCTTCACTTGG 0: 1
1: 0
2: 1
3: 18
4: 172
Right 925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 125
925072848_925072855 26 Left 925072848 2:984612-984634 CCATGAGGTCAGCTGTGGCCCTG 0: 1
1: 0
2: 3
3: 43
4: 341
Right 925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 125
925072850_925072855 7 Left 925072850 2:984631-984653 CCTGCCGTCCTGAAATTGCTCCT 0: 1
1: 0
2: 1
3: 11
4: 134
Right 925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 125
925072851_925072855 3 Left 925072851 2:984635-984657 CCGTCCTGAAATTGCTCCTTCAC 0: 1
1: 0
2: 0
3: 19
4: 250
Right 925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 125
925072849_925072855 8 Left 925072849 2:984630-984652 CCCTGCCGTCCTGAAATTGCTCC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925072855 Original CRISPR GCACATCCTGCCATCATCAG CGG Intronic
903326453 1:22571574-22571596 GGACCACCTGCCATCTTCAGGGG + Intronic
904378535 1:30096403-30096425 GCACATCCTGCCGGGAGCAGTGG + Intergenic
905228376 1:36494675-36494697 TCCCATCCTGCCACCATCTGGGG + Intergenic
910721166 1:90287652-90287674 GCTCATCCTGCCAACATCATTGG + Intergenic
916047802 1:161013728-161013750 CCACTTTCTGCCATCCTCAGAGG - Intronic
920311052 1:205048479-205048501 GCACAGGCTGTCATCAGCAGGGG - Intronic
920539709 1:206769171-206769193 GCACAGAGTGCCAACATCAGGGG - Intronic
921175995 1:212595085-212595107 GCTCATCTTACCATCCTCAGTGG - Intronic
922278038 1:224097443-224097465 TCACTGCCTGCCATCTTCAGGGG - Intergenic
922419678 1:225451133-225451155 GCACATGCTGCCCTCATGACTGG + Intergenic
1063129158 10:3162595-3162617 CCACATCCTACCATCATGTGAGG - Intronic
1064347766 10:14548358-14548380 GCACCTCCTGCCAGCTCCAGGGG + Intronic
1065666896 10:28072598-28072620 CCAAATCCTGCCATCATCTTGGG + Intronic
1067662976 10:48250257-48250279 GCAAATTCTACCATCATCATGGG + Intronic
1069039555 10:63681068-63681090 GCAGCTCCTCCCAGCATCAGTGG - Intergenic
1070568260 10:77620227-77620249 CCACAGCCTGCCAGCCTCAGAGG + Intronic
1070957458 10:80473876-80473898 GCCCCTCCTTCCATCCTCAGAGG + Intronic
1074288817 10:112122908-112122930 GCACATTCTTCCATCACTAGGGG + Intergenic
1075421574 10:122304969-122304991 GCACATCATGACATGCTCAGCGG - Intronic
1078262778 11:9726510-9726532 TCATATCCTGCCATCCTAAGAGG - Intronic
1078752856 11:14181372-14181394 TGACTTCCTGCCATCAGCAGTGG - Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1082770112 11:57201334-57201356 TCACATCCTGGCATCATCCGGGG - Intergenic
1085212054 11:74790553-74790575 GCACAGCCTGCCAGGATAAGTGG - Intronic
1090514490 11:127411303-127411325 GCACAGCCTGCCAGCCTGAGTGG - Intergenic
1091945012 12:4531819-4531841 CCACATCCTGCCATCAACCTGGG + Intronic
1092749061 12:11701581-11701603 GCACATCCTGTCTTCCTGAGTGG + Intronic
1098136169 12:67404779-67404801 GCACATACTTGCATTATCAGTGG + Intergenic
1101753899 12:107606112-107606134 CCCCATCCTGCCCTCTTCAGTGG - Intronic
1102574826 12:113849777-113849799 GCACTTCCTGCCATCATTGATGG + Intronic
1103329305 12:120142780-120142802 GCACACCCTACCATCAGCAGGGG + Intronic
1105252702 13:18714900-18714922 GCTCATCCTGCCAACATCATTGG - Intergenic
1109745451 13:66617796-66617818 GCAGATGGGGCCATCATCAGAGG - Intronic
1109865800 13:68261233-68261255 GCAGATGGGGCCATCATCAGAGG - Intergenic
1111694989 13:91612310-91612332 ATAAAACCTGCCATCATCAGTGG + Intronic
1111752018 13:92344707-92344729 GAACCTCCTGCCAGCACCAGAGG + Intronic
1112000791 13:95207963-95207985 TCACAGCCTGCCCTTATCAGCGG + Intronic
1113866686 13:113531090-113531112 GCACCCACTGCCACCATCAGTGG + Intronic
1116689017 14:48081066-48081088 GCACATCCGTCCATCCACAGTGG + Intergenic
1122357793 14:101134399-101134421 GATCAGCCTCCCATCATCAGAGG - Intergenic
1122505843 14:102231231-102231253 GCACTTCGTCCCATCAGCAGAGG - Intronic
1124199791 15:27669125-27669147 GAACGTACTGCCTTCATCAGAGG - Intergenic
1126441789 15:48697458-48697480 GAATATCCTGCCATAATCAGAGG - Intergenic
1127973103 15:63977612-63977634 GTACATGGTGTCATCATCAGGGG + Intronic
1129985864 15:79919408-79919430 GTGCATCCTGCCACCCTCAGAGG - Intronic
1131853089 15:96563571-96563593 GCACATCCAGCCAACCTCTGGGG - Intergenic
1131962242 15:97801850-97801872 ACCCATCCTTCCATCAGCAGAGG + Intergenic
1133740041 16:8644513-8644535 GCACAAACTGCCATCATCAATGG - Intronic
1135036645 16:19084029-19084051 TCTCATCCTGCCATCATCTTTGG - Intergenic
1135056934 16:19239762-19239784 GCACAGCCTGCCAGGATGAGTGG - Intronic
1137373404 16:47929634-47929656 GCCCATCCTGCCATGGTGAGTGG - Intergenic
1138350260 16:56342562-56342584 TCACATGCTGCCTTCCTCAGGGG - Intronic
1141618112 16:85221622-85221644 GCACGTCCTGGCCTCGTCAGGGG - Intergenic
1141910454 16:87055020-87055042 TCAGACCCTGGCATCATCAGAGG + Intergenic
1143619216 17:8071659-8071681 CAACATGCTGCCATCAACAGCGG + Intergenic
1145066166 17:19762692-19762714 GCTCAACCTGCCAGCAGCAGAGG - Intergenic
1145960163 17:28882600-28882622 GCCCATGCGGCCAACATCAGGGG + Exonic
1146141150 17:30369081-30369103 GCTCATCCTGCCAGCACCACTGG + Intergenic
1146637773 17:34518894-34518916 GCATATCCTGCCAGCAGCCGTGG + Intergenic
1149362391 17:55909856-55909878 GCACAGCCTGCCAGCCTGAGTGG - Intergenic
1150350761 17:64442811-64442833 CCACACCCTGCCACCACCAGGGG - Intergenic
1151303739 17:73249261-73249283 GCAGATCCAGCCAACATCTGGGG + Intronic
1151893032 17:76962417-76962439 GCACCTCCTCCCATCATCTCAGG - Intergenic
1153834196 18:8949571-8949593 GCAGGTCCTGCCATGCTCAGGGG - Intergenic
1155070383 18:22309784-22309806 GCCCATCCTGCCTTCCACAGTGG - Intergenic
1164566932 19:29332650-29332672 GCACAGCCTGCCATGATGACTGG - Intergenic
1164790400 19:30972580-30972602 GCACCTCCTGTCATCTGCAGAGG - Intergenic
1164931706 19:32180739-32180761 GCACAGCCTGCCAACCTGAGTGG + Intergenic
1167517713 19:49932844-49932866 CCACATCCTGCCACCACCCGAGG + Exonic
925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG + Intronic
926336557 2:11866983-11867005 GCATATCATGCCATTATAAGTGG - Intergenic
926421875 2:12707931-12707953 CCACAGCCTGCCAGCATCTGGGG - Intergenic
927801308 2:26102111-26102133 GCAGATCCTGCCACTATCATGGG - Intronic
928299988 2:30116479-30116501 GCACAACCTGCCTTCATAACAGG - Intergenic
929911753 2:46096012-46096034 CCACATCCTACCACCATCACTGG + Intronic
933682323 2:85113218-85113240 GCCCAACCTGCCAGCAGCAGAGG + Intergenic
934681992 2:96290748-96290770 GCACATACAGTCATCATCAAAGG - Exonic
935551859 2:104466304-104466326 CCACATCTTCCCATCATCTGGGG - Intergenic
938460032 2:131491306-131491328 TCTCTTCCTGCAATCATCAGAGG + Intronic
940933356 2:159463045-159463067 TCACATCCTTCCATCTTCACGGG + Intronic
944682082 2:202086256-202086278 GCACATCTTGCCATCCGCACAGG + Intronic
947108393 2:226691966-226691988 GCACTTCCACCCATCACCAGGGG - Intergenic
948344406 2:237282994-237283016 GAACACCCAGTCATCATCAGAGG - Intergenic
948635325 2:239330927-239330949 GCACAGCCTGTCCTCTTCAGTGG - Intronic
1175037881 20:56017423-56017445 GTACATCCTGCTACCACCAGTGG + Intergenic
1176838220 21:13814787-13814809 GCTCATCCTGCCAACATCATTGG - Intergenic
1177146647 21:17413746-17413768 TCAAATCCTGCCATCATCCTGGG - Intergenic
1179044960 21:37835661-37835683 CCAAACCGTGCCATCATCAGAGG - Intronic
1181172905 22:21020072-21020094 GCACATCCTGCCAGGCACAGTGG - Intronic
1185257801 22:49845797-49845819 CCCCACACTGCCATCATCAGTGG + Intergenic
954690790 3:52394672-52394694 GCTCATCCTGCCATATTCTGGGG - Intronic
955045150 3:55352624-55352646 GCTCATCCTGCTAACATCTGGGG - Intergenic
955377496 3:58410535-58410557 GCACATCCTCCCATCACATGGGG - Intronic
958450013 3:94260958-94260980 GCACATCCTGCCAAGCTAAGTGG - Intergenic
961504847 3:127363148-127363170 GCACAGCCTGGCTTCATTAGTGG - Intergenic
964639388 3:158892441-158892463 GCACCTCCTGCCACCATGAGTGG + Intergenic
967889796 3:194356916-194356938 GCACAGCAGGCCACCATCAGCGG + Intronic
969610387 4:8224814-8224836 GGACATCCTCCCATCATCAGTGG - Intronic
971948852 4:33316725-33316747 GCACACCCTGCCATGGTGAGTGG - Intergenic
973056494 4:45665855-45665877 ACACATTCTTCCATGATCAGGGG + Intergenic
973212500 4:47631965-47631987 GAACATCCTGACATTATGAGAGG + Intronic
976634076 4:87270129-87270151 GCAAATGCTGCCATCACAAGTGG - Intergenic
979725145 4:123952213-123952235 GCACATTCTGCCTTCAGCATTGG + Intergenic
980003963 4:127519821-127519843 GCATATCCTGCAATCAACATTGG - Intergenic
982019917 4:151192507-151192529 GACTATCCTGCCATCACCAGTGG + Intronic
983207911 4:164930613-164930635 GCACATCCTTCCATCCACTGTGG + Intergenic
987905686 5:24073120-24073142 GCACATCCTACAGTCATCCGTGG - Intronic
989054212 5:37351232-37351254 GAAAATTCTGCCATTATCAGTGG + Exonic
992472788 5:77075026-77075048 GCACATCCTGCCTCTATGAGTGG - Exonic
1001097914 5:168790205-168790227 GCACATCCTGGGATTCTCAGGGG + Intronic
1002100451 5:176855116-176855138 GCTCCTCCTGCCAGCATCAGAGG - Intronic
1003708392 6:8561213-8561235 GCACATGCTGCCCACATCACGGG + Intergenic
1004228672 6:13811983-13812005 GCATTTCCTTCCCTCATCAGGGG - Intronic
1004948487 6:20641958-20641980 GCGTAGCCTGCCATCAGCAGAGG + Intronic
1007650112 6:43413997-43414019 GCACAGCCTGCCAGCCTGAGTGG + Intergenic
1019224949 6:170501695-170501717 GCATATCCCGCAACCATCAGGGG + Intergenic
1019225332 6:170503548-170503570 GCACATCCTGCAGCCATCAGGGG + Intergenic
1019225341 6:170503584-170503606 GCACATCCTGCAGCCATCAGGGG + Intergenic
1019225475 6:170504160-170504182 TCACATCCTGCAGCCATCAGGGG + Intergenic
1024806413 7:53147019-53147041 TCACATCATATCATCATCAGAGG - Intergenic
1024806558 7:53148202-53148224 TCACATCATAGCATCATCAGAGG + Intergenic
1025006496 7:55359789-55359811 GCCCAGTCTGCCATCAGCAGGGG - Intergenic
1025618168 7:63142623-63142645 CCACCTCCTGCCACTATCAGTGG - Intergenic
1026370310 7:69691794-69691816 GCCGCTGCTGCCATCATCAGTGG + Intronic
1026837872 7:73650111-73650133 CTACCTCCTGCCATCACCAGGGG - Intergenic
1029970979 7:104788979-104789001 GCAATTGCTTCCATCATCAGTGG - Intronic
1031358622 7:120820052-120820074 ACACTTGCTGCCACCATCAGGGG - Intronic
1031544189 7:123032150-123032172 GCACCTCCTACTATCATCACTGG - Intergenic
1034577301 7:152011481-152011503 GCACACCTTGCCAGCATCTGGGG - Intronic
1039211924 8:35226945-35226967 GCATGTCCTGCTGTCATCAGAGG + Intergenic
1049048709 8:140173910-140173932 ACAGATGCTGACATCATCAGAGG - Intronic
1051123635 9:13779034-13779056 GGAAATCATGCCATCCTCAGAGG + Intergenic
1052421647 9:28250607-28250629 GCCCATTCAGCCATCATGAGCGG - Intronic
1058081331 9:100703769-100703791 ATACATCATGCCATCAGCAGGGG + Intergenic
1062109453 9:134773972-134773994 GCACAGCCTCTTATCATCAGAGG + Intronic
1186162094 X:6788377-6788399 TTATATCCTGTCATCATCAGTGG - Intergenic
1192576450 X:72246822-72246844 CCACATCCTGCCTTTATCATTGG + Intronic
1199363507 X:146950033-146950055 GCACTTACTACCATTATCAGAGG - Intergenic
1201501181 Y:14644556-14644578 GCACATCCTTCAGTCATCAGTGG + Intronic