ID: 925074397

View in Genome Browser
Species Human (GRCh38)
Location 2:1002407-1002429
Sequence AAAAGCAACCACTTAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 551}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925074396_925074397 12 Left 925074396 2:1002372-1002394 CCAGAATCTACAAGGAATGCAAA 0: 9
1: 106
2: 1206
3: 15778
4: 12911
Right 925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG 0: 1
1: 0
2: 2
3: 63
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925074397 Original CRISPR AAAAGCAACCACTTAAAAGT AGG Intronic
902324130 1:15687501-15687523 AAAAGCTACCAGTTAAGACTGGG - Intronic
902958930 1:19948155-19948177 AAAAAAAACCATTAAAAAGTGGG - Intergenic
903093071 1:20940459-20940481 AAAAGCCACATCTCAAAAGTAGG + Intronic
903843807 1:26264546-26264568 AAAAGGAAGCATTTAAAAGCTGG + Intronic
904904333 1:33883762-33883784 AAAAGAAACATCTTGAAAGTGGG - Intronic
905518963 1:38582979-38583001 ACAAGCAACCTGTTAAAGGTGGG + Intergenic
906737693 1:48147822-48147844 AAAAGCAATAATTTATAAGTAGG + Intergenic
907229750 1:52985216-52985238 CAAAGAAACCCCTAAAAAGTAGG - Intronic
908371453 1:63483510-63483532 AAAAGCAACAAATCAAAAGCTGG - Intronic
908507634 1:64821237-64821259 AAAAACAACCCCATTAAAGTGGG - Intronic
908803201 1:67901904-67901926 AAAAAAAACCATTAAAAAGTGGG - Intergenic
908981263 1:69962141-69962163 AAAAAAAAACATTTAAAAGTGGG + Intronic
909232479 1:73107310-73107332 AAAACCAAATACTTAAAAGTGGG + Intergenic
910154612 1:84200494-84200516 AAAAGCAAACACTGTCAAGTGGG - Intronic
910208425 1:84770772-84770794 AAAAGTAATGACTTAACAGTGGG - Intergenic
910330309 1:86065848-86065870 AAATGCAAGTACTTAACAGTGGG + Intronic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
910740666 1:90512653-90512675 AAAACCTACCACTAAAAAATAGG - Intergenic
910780427 1:90926422-90926444 AAAAGCAAGCCCTTCAAAGGAGG - Intronic
910848177 1:91624038-91624060 AAAAAAAAACACTAAAAAGTTGG + Intergenic
910898483 1:92093498-92093520 AAAAGCATACACTTTAAAATTGG - Intronic
911194464 1:94979631-94979653 AAAGGCAACCAATTATAATTGGG + Exonic
911319703 1:96398103-96398125 AAAAGGAAACAATTAAAATTGGG + Intergenic
911649333 1:100369735-100369757 AAAAGCAAACATTGACAAGTGGG - Intronic
911979046 1:104542864-104542886 CAAAGAAACAACTAAAAAGTTGG + Intergenic
911999496 1:104812816-104812838 AAAAGAAAAAATTTAAAAGTGGG + Intergenic
912326141 1:108764718-108764740 AAAAAAAACCATTAAAAAGTGGG - Intronic
913289029 1:117255362-117255384 CAAAGCAGCCACTTCAAAGAAGG - Intergenic
916370325 1:164086841-164086863 AAAGGCAACCACTTCAGAGAAGG - Intergenic
916395167 1:164379103-164379125 AAAAGCTAACACTGAAAAGCTGG + Intergenic
917756604 1:178106440-178106462 AAAAGCAGCCATTTCAAAATAGG - Intronic
917952258 1:180051395-180051417 AAAAGCCACAACTAAAGAGTTGG + Intronic
917992674 1:180398339-180398361 AAAAGCAAGCACTTAAACCTAGG + Intronic
918457545 1:184738781-184738803 AAAAGCAACCAATGGAAAGATGG - Intronic
918802383 1:188987575-188987597 CAAAGCAACCACTTGAATTTTGG + Intergenic
918872401 1:189992545-189992567 AAGGGCAACAACCTAAAAGTAGG - Intergenic
918925909 1:190785726-190785748 AAAAGCAAACATTGAAAAATGGG + Intergenic
919437081 1:197575247-197575269 AAAAAAAACCATTAAAAAGTGGG + Intronic
920042566 1:203111866-203111888 AGAGGCAACCACTTTTAAGTGGG - Intronic
920637109 1:207714284-207714306 CAAAGCCACCACTCAAAGGTGGG + Intronic
921767310 1:218987489-218987511 GAAAAAAAACACTTAAAAGTGGG - Intergenic
924125341 1:240844503-240844525 AAAAGCACCAACTTAATAATAGG + Intronic
924312317 1:242756920-242756942 AACAACAACAACATAAAAGTGGG + Intergenic
1065711524 10:28522620-28522642 CAAAGCCATCACTGAAAAGTTGG + Intergenic
1066211361 10:33242208-33242230 AAAATCAACCACTTGTAAATAGG - Intronic
1067847045 10:49732861-49732883 AAAACCAACCACATAAAAAACGG - Intergenic
1067929772 10:50548860-50548882 AAAAAAAACCATTAAAAAGTGGG + Intronic
1068330339 10:55557413-55557435 AAAATCAACAAGTTAAATGTAGG + Intronic
1068565682 10:58572158-58572180 AAAAAATCCCACTTAAAAGTGGG - Intronic
1069199804 10:65598935-65598957 AAAAGCAACCTATTAAAAAGTGG - Intergenic
1069359891 10:67630161-67630183 AAAAGGAACCCCTAAAAAGAAGG + Intronic
1070041167 10:72781744-72781766 AAAAGAAATAACATAAAAGTAGG - Intronic
1070946807 10:80399060-80399082 AAAAGCAAACAAATAAAAATAGG - Intergenic
1071455087 10:85841638-85841660 AAAAGAAAACATTAAAAAGTGGG + Intronic
1071751743 10:88486522-88486544 AAAAAAAACCATTAAAAAGTGGG + Intronic
1071913736 10:90266657-90266679 AAAACCAAACACTTATAAGTGGG + Intergenic
1071953491 10:90731033-90731055 TAAGGCAACCACTTAAAATTTGG + Intergenic
1071989854 10:91091088-91091110 AAAAGCAAGCAATGCAAAGTAGG - Intergenic
1072475518 10:95756328-95756350 AAAAGCAAGTACTTGAAAGCTGG + Intronic
1072960506 10:99924919-99924941 GAAAGCAGTCCCTTAAAAGTTGG - Intronic
1073365434 10:102936418-102936440 AAAAGCAATGACTAAAAGGTAGG - Intronic
1074589730 10:114801413-114801435 AAAAAAATCCACATAAAAGTGGG + Intergenic
1074916656 10:117963309-117963331 AATAGCAAACACTTAGAAGATGG - Intergenic
1076517412 10:131055421-131055443 CAAAGCAGCCACCTAAAAGCAGG + Intergenic
1077202005 11:1313209-1313231 AAAAAATCCCACTTAAAAGTGGG - Intergenic
1077852768 11:6090421-6090443 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1078955462 11:16189216-16189238 AAAAGCAACAAATTAACAGAAGG + Intronic
1079214919 11:18500659-18500681 AAAACAAACCATTAAAAAGTGGG - Intronic
1079437365 11:20471055-20471077 AAAAAAAACCATTAAAAAGTGGG - Intronic
1079507052 11:21164848-21164870 AAAAGCAGGCAATTAAATGTAGG - Intronic
1079909199 11:26288250-26288272 AAAAGCAAGTAATTAAAAGCAGG - Intergenic
1080182794 11:29444565-29444587 AAAAGCAAAAACTGACAAGTGGG - Intergenic
1080206945 11:29740269-29740291 ACATGCAACCACTTCAAAATGGG - Intergenic
1080257824 11:30311665-30311687 AAAATCAAGCACTTAAGAGGAGG - Intergenic
1081268061 11:41051209-41051231 AAAAGCTAACACTTAAATGTTGG + Intronic
1082078413 11:47993158-47993180 AAAAGCAGCTACTTAAAGGCAGG - Intronic
1082939293 11:58687165-58687187 AAAAGTAAACAAATAAAAGTAGG - Intronic
1083062359 11:59887096-59887118 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1083106239 11:60361061-60361083 CAAAGACACCACTCAAAAGTGGG + Intronic
1083531204 11:63424070-63424092 ACAAACAACCATTAAAAAGTGGG + Intergenic
1083604203 11:63967886-63967908 TAAAGTAACAACTTAAAAGGGGG - Intergenic
1084486721 11:69452437-69452459 AAAGGGAACCATTTAAAAGGAGG + Intergenic
1084990591 11:72920614-72920636 AAAATCAACCACTTCATAGAAGG + Intronic
1085505315 11:77055532-77055554 AAAAACAACCTCTTGAAAGCAGG - Intergenic
1085726878 11:78962103-78962125 AAAAACAAACCCTCAAAAGTAGG + Intronic
1085915356 11:80880834-80880856 AAAAGCAAAAACTGATAAGTGGG + Intergenic
1086568713 11:88258199-88258221 AAAAGCAACAATTGACAAGTGGG - Intergenic
1086741513 11:90375287-90375309 AAAAAAATCCATTTAAAAGTGGG - Intergenic
1086892772 11:92277629-92277651 CAATGCTACCACTTACAAGTGGG - Intergenic
1087033281 11:93728231-93728253 AAAAGCAGCCACATAAAACGTGG - Intronic
1087299536 11:96415773-96415795 AAAAACAAAAATTTAAAAGTTGG + Intronic
1087551898 11:99661453-99661475 ATAAGCAATCACTTAATAATGGG + Intronic
1087686358 11:101270085-101270107 AAAAGCAAAAGCTTGAAAGTGGG + Intergenic
1087805447 11:102550737-102550759 AAAAGCAATCATTTAATAATTGG - Intergenic
1088325787 11:108599676-108599698 AAAGGCAACCACATGGAAGTAGG - Intergenic
1088453309 11:110005720-110005742 ATAAACAACCCCTTAAAATTGGG + Intergenic
1089049245 11:115531787-115531809 AGAAGCAACCATTCAAAAGTAGG - Intergenic
1089515892 11:119031066-119031088 GAATGCAACCACTTAAGAATTGG - Intergenic
1089831193 11:121329795-121329817 GAATGCAAACATTTAAAAGTTGG - Intergenic
1090050724 11:123376495-123376517 AAAAGCCATACCTTAAAAGTAGG - Intergenic
1090172933 11:124620701-124620723 AATAGCAAGCACTTACAAATGGG + Intergenic
1090567566 11:128011730-128011752 AAAAGCAAACATTGAAAAATGGG + Intergenic
1090587063 11:128224379-128224401 AAAAAAAACCATTAAAAAGTGGG + Intergenic
1092325108 12:7522723-7522745 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1092724284 12:11469781-11469803 AAAAAAAACCATTAAAAAGTGGG + Intronic
1093899625 12:24616306-24616328 AGAAGCAATCACTTAGAAGATGG + Intergenic
1094207616 12:27857251-27857273 AAAAGAAAACACTAAAAAGTGGG - Intergenic
1094384889 12:29883704-29883726 AAAAGCAATTACATAAAATTTGG - Intergenic
1094764818 12:33580940-33580962 AAAATGAACCAATTAAAAATGGG + Intergenic
1095222374 12:39631443-39631465 AAAAATAACCAATTAAAAGTAGG - Intronic
1095736537 12:45562861-45562883 AAAACAAACCAATTAAAAGTGGG - Intergenic
1096206173 12:49723824-49723846 AAAAAAAACAACATAAAAGTGGG - Intronic
1096826421 12:54281645-54281667 AAAAGCTACCTCTTAAATCTAGG + Intronic
1097420733 12:59375656-59375678 AAAGGGAACCACATAAAAATTGG + Intergenic
1097933691 12:65220579-65220601 AAAAGCAAAAACAGAAAAGTGGG - Intronic
1097997269 12:65902153-65902175 AAAAAAAAACTCTTAAAAGTAGG - Intronic
1098251422 12:68573786-68573808 AAAAAGAACCCCTAAAAAGTTGG - Intergenic
1098711771 12:73771825-73771847 CAAAGATACCACTTAAAGGTGGG + Intergenic
1098764720 12:74471585-74471607 AAAAAAAACCACTAAAAAGTGGG + Intergenic
1098821692 12:75239066-75239088 ATAAACAACCAATTAAAAATGGG - Intergenic
1099565107 12:84232453-84232475 AAAAGCAGTAACTTTAAAGTTGG + Intergenic
1099753441 12:86807956-86807978 AAAAAAAACCATTAAAAAGTGGG - Intronic
1099792813 12:87358554-87358576 AAAAGCAACCCCATCAAAATTGG - Intergenic
1100065053 12:90633864-90633886 AAAAGCAACCACATCAAAAGTGG + Intergenic
1100921124 12:99488447-99488469 AAGAGAAACCACTAAAAATTAGG - Intronic
1101049084 12:100842284-100842306 CAAAACAACCACATAAAAGATGG - Intronic
1101188031 12:102301569-102301591 AACAGCAACCACAAGAAAGTTGG - Intergenic
1101447090 12:104744614-104744636 AAAAGCAAAAACTGACAAGTGGG - Intronic
1102534708 12:113572408-113572430 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1103950359 12:124547530-124547552 AAAATTAACCACTATAAAGTAGG + Intronic
1104348241 12:128021825-128021847 AAAAGCAAGGACTTAAAGGTAGG + Intergenic
1104863758 12:131940558-131940580 AAAAACAAAAACTTAACAGTGGG - Intronic
1104877044 12:132042420-132042442 AAAAGCACCCACTATAAAGACGG - Intronic
1105454808 13:20530473-20530495 AAAAACAAACAATTAAAACTAGG + Intergenic
1106148826 13:27078099-27078121 ATAACCAACTACTTAAAATTTGG + Intronic
1107220685 13:37975919-37975941 AAAAGCAACTATTTAACAGCAGG - Intergenic
1107250866 13:38361050-38361072 AAAAGCTTCCAGTTAACAGTTGG - Exonic
1107896835 13:44973554-44973576 AGAAGCAGCCAGGTAAAAGTTGG + Intronic
1109087074 13:57987223-57987245 AAAAGAAATCTATTAAAAGTTGG + Intergenic
1109370905 13:61417681-61417703 ACAAGCAACCACTGCAAAGTAGG - Intronic
1109492870 13:63126587-63126609 CAAAGGCACCACTCAAAAGTGGG - Intergenic
1109501339 13:63239633-63239655 AATTTCAACCAGTTAAAAGTGGG + Intergenic
1109558603 13:64016396-64016418 AAAAGTACCCAATTAAATGTGGG - Intergenic
1109573322 13:64221162-64221184 AAAAGCAAAAACTGATAAGTGGG - Intergenic
1110057102 13:70986894-70986916 CAAAGGCACCACTTAAAGGTGGG - Intergenic
1111077348 13:83254553-83254575 AAAATAAACCATTAAAAAGTGGG + Intergenic
1111310005 13:86472143-86472165 CAAAGCCACCACTCAAAGGTGGG + Intergenic
1111371629 13:87326845-87326867 AAAAAAAACCACTAAAAAGTAGG + Intergenic
1111374947 13:87366556-87366578 AAAAGCAACAACAAAAAAGCAGG - Intergenic
1111796323 13:92924908-92924930 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1111840987 13:93450706-93450728 AAATACAGCCACTAAAAAGTGGG - Intronic
1112106783 13:96249175-96249197 AAAAGCAACTAGTTGAAAATGGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112401216 13:99080094-99080116 AAAAGAAACCACATAAAACATGG - Intronic
1112566681 13:100557870-100557892 AAAACAATCCAATTAAAAGTAGG + Intronic
1112829060 13:103426366-103426388 CAAACCAACTACTTAAAAGTTGG + Intergenic
1113453369 13:110429161-110429183 AAAAACAAAAACTTTAAAGTGGG + Intronic
1113927982 13:113951742-113951764 AAAGGCAACCACTTTGAAATGGG - Intergenic
1114594041 14:23895905-23895927 CAAAGCTACCACACAAAAGTTGG + Intergenic
1115558901 14:34565403-34565425 AAACCCAACCATTTAAAAATGGG + Intronic
1115903391 14:38179571-38179593 AATAAGAACCACTTTAAAGTAGG + Intergenic
1116866146 14:50033244-50033266 AAATGCAGCCTCTTAAAAATGGG + Intergenic
1117608488 14:57457097-57457119 TATAGCAACCACTTAAAAAAAGG - Intergenic
1118829338 14:69415452-69415474 ACAAACAACCAATTAAAAATGGG - Intronic
1118964965 14:70572752-70572774 AAAAACCACCATTGAAAAGTAGG + Intergenic
1119221227 14:72909362-72909384 AACAGCCTCCACTTAAAACTAGG + Intergenic
1119501235 14:75129136-75129158 AAAACCAATTACTTAAAATTGGG + Intergenic
1121707735 14:96011592-96011614 GAAAGAAATGACTTAAAAGTTGG - Intergenic
1122454624 14:101840693-101840715 AATAGGAACTACTTAAATGTTGG - Intronic
1122656342 14:103262547-103262569 AAAAACAACCACATTAAAATGGG - Intergenic
1123575654 15:21665280-21665302 AAAAAAATCCACTTAAAAATGGG + Intergenic
1123612274 15:22107753-22107775 AAAAAAATCCACTTAAAAATGGG + Intergenic
1123826438 15:24086801-24086823 ATAAGCGACCACTCAAAGGTGGG + Intergenic
1123851338 15:24360595-24360617 AAAAGAAACAATTTAAAAATGGG - Intergenic
1124194717 15:27612721-27612743 AATAGCAACCACTTTAAATGTGG + Intergenic
1125247852 15:37661915-37661937 AAAAAAAACCATTCAAAAGTGGG - Intergenic
1125453940 15:39838165-39838187 TAAAGCAACAATTTAAATGTAGG + Intronic
1126880985 15:53097258-53097280 AAAACCATTCAATTAAAAGTGGG - Intergenic
1126938095 15:53734508-53734530 GGAAGCAACAACTTAAAAATAGG - Intronic
1127180795 15:56415246-56415268 AAAAGCAAAAACTGACAAGTGGG - Intronic
1127306220 15:57707774-57707796 AAAACCAAACACTTAAAAGCTGG + Intronic
1127542748 15:59958434-59958456 AAATGAAACCACTTATAAGGAGG - Intergenic
1128434682 15:67634980-67635002 TAAAGCAATCACTTAAAAAAGGG - Intronic
1129339175 15:74873613-74873635 TAAAGCAAACTCTCAAAAGTGGG + Intergenic
1131720199 15:95159806-95159828 AGAAATAACCACTTAAAGGTTGG + Intergenic
1202984522 15_KI270727v1_random:399525-399547 AAAAAAATCCACTTAAAAATGGG + Intergenic
1133565497 16:6989588-6989610 GAATGCAACCATTTAAGAGTGGG + Intronic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1134740259 16:16536699-16536721 AAAAGTAACCACTTAATAAATGG + Intergenic
1134927241 16:18175462-18175484 AAAAGTAACCACTTAATAAATGG - Intergenic
1135290416 16:21232530-21232552 TAAGACAACCACTTAAAAATTGG + Intergenic
1135942779 16:26836893-26836915 AAAATCAACCATTAAAAAGCTGG + Intergenic
1137310440 16:47251512-47251534 AAAAGCAACAGCTTAAGAGAAGG + Intronic
1137325725 16:47434362-47434384 AAAAAAAACCATTCAAAAGTGGG + Intronic
1137632348 16:49955739-49955761 GAATGTAACCACTTAAAAATAGG - Intergenic
1137892134 16:52173898-52173920 AAAAGAAAGCACTTAAGAGAAGG + Intergenic
1138242440 16:55438160-55438182 AAAAGCAATCCCTTAAAATCAGG + Intronic
1138993420 16:62419357-62419379 TAAAGCAACAACTTAAATGCTGG - Intergenic
1139232594 16:65299054-65299076 AAAAACAACCCCTTAAAAAGTGG + Intergenic
1139387814 16:66585455-66585477 AAAAGCAAGCATTGAAAGGTAGG + Intronic
1141332492 16:83124348-83124370 AAAATGACCCAATTAAAAGTGGG - Intronic
1142018498 16:87765549-87765571 AAAAGCAAGCACGTTAAAGGGGG + Intronic
1142635108 17:1252339-1252361 AAAACCTACCACTAAAATGTGGG + Intergenic
1143815585 17:9510809-9510831 AAAATCAACAAAATAAAAGTTGG + Intronic
1144310729 17:14011859-14011881 AAATGCAACCACTTTCAGGTTGG + Intergenic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1146618864 17:34380486-34380508 AACAGCAAACACTTAAAACAGGG + Intergenic
1146622505 17:34410037-34410059 AAAAGCAAACATTGACAAGTGGG + Intergenic
1147231387 17:39021265-39021287 AAAAGGCACCACTTAAAGATGGG - Intergenic
1148010611 17:44477710-44477732 AAAAAAAAGGACTTAAAAGTGGG + Intronic
1148022301 17:44561493-44561515 ACAAGCAAACACTTCGAAGTAGG - Intergenic
1148401948 17:47371045-47371067 AAAAACAACCATTAAAAACTGGG - Intronic
1149063848 17:52456980-52457002 AAAAGCAAAAACTGACAAGTGGG + Intergenic
1149405050 17:56340314-56340336 AAAAGCAAAAACTGACAAGTGGG - Intronic
1149482399 17:57014401-57014423 AAAAGCAAACACATAAACATAGG - Intergenic
1149716531 17:58795863-58795885 AAAACAAAACATTTAAAAGTGGG - Intronic
1151034129 17:70778994-70779016 AAAAGCAACATTTTAAAAATGGG + Intergenic
1153228767 18:2917584-2917606 AAAAGAAAAAACTTAAAAATGGG - Exonic
1153259898 18:3214140-3214162 AATAGCAAATACTTAAAATTCGG - Intronic
1153764881 18:8365845-8365867 CAAAACAATCACTTAATAGTCGG + Intronic
1153870368 18:9313590-9313612 AAAAAAAACCATTGAAAAGTGGG - Intergenic
1153886446 18:9472212-9472234 AGAAGCAAACTCTTGAAAGTAGG - Intergenic
1155105790 18:22664748-22664770 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1156136038 18:34039202-34039224 CAATGTAACCACTTAAAATTAGG - Intronic
1156146304 18:34184828-34184850 AAAATAAACCACTTAAAAATAGG + Intronic
1156364298 18:36411531-36411553 AAATGCAGCCACTAAAAAATAGG - Intronic
1156582187 18:38390695-38390717 AGAAACAACCCCTTAAAAGGAGG + Intergenic
1156662977 18:39369804-39369826 AAAAGCAAAAACTAACAAGTAGG + Intergenic
1156705892 18:39881913-39881935 ACAAACAACCATTTAAGAGTGGG + Intergenic
1156868102 18:41911616-41911638 AAAAGCTACCACTCTAAACTTGG - Intergenic
1157363546 18:47042029-47042051 AAAAAAATCCACTTAAAAATGGG - Intronic
1158216698 18:55108054-55108076 AAAAACTACCATTTAAAATTTGG + Intergenic
1158299741 18:56037820-56037842 AAAAGCAACCACATAAAAACTGG + Intergenic
1158869534 18:61671422-61671444 AAAAGGAACAACTTACATGTTGG - Intergenic
1159068963 18:63601313-63601335 AAAAAAAACCATTAAAAAGTGGG - Intronic
1159297672 18:66517239-66517261 AAATGCAACCACTGAAATTTAGG + Intronic
1159593554 18:70360811-70360833 AAAAGCAAGCACTTCAAAGAAGG + Intergenic
1159759280 18:72405167-72405189 AAAAGCAAACTCTTAAATGCAGG - Intergenic
1159836318 18:73340675-73340697 ACATACAACCACTTAAAATTTGG - Intergenic
1160945326 19:1640056-1640078 CAAAGAAACCACCTAAAAGTTGG + Intronic
1166265235 19:41677807-41677829 AAATGCAACCATGAAAAAGTGGG - Intronic
1166588636 19:43974550-43974572 AAAAAAAACCATTAAAAAGTGGG + Intronic
1167836957 19:52080870-52080892 CAAAGCAACCACCCAAAACTGGG + Intronic
1168042083 19:53766621-53766643 CAAAGCAAGCACTTAAGTGTGGG + Intergenic
1168229703 19:55021983-55022005 AAAAAAAACCATTAAAAAGTGGG - Intronic
1168305921 19:55435777-55435799 AAAAGGATCCACCAAAAAGTGGG + Intronic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
926473043 2:13285212-13285234 AAAAGATACCACTCAAAGGTGGG + Intergenic
926821832 2:16859977-16859999 AAAAAAAACCACCAAAAAGTGGG - Intergenic
926984074 2:18602183-18602205 AAATGCAAACACAGAAAAGTTGG - Intergenic
927024080 2:19047799-19047821 TAAAGCAGCCACTTAAAAGAAGG + Intergenic
927461531 2:23303063-23303085 AAAAGTAACCACTAGAAAATGGG + Intergenic
927834807 2:26386393-26386415 ACCAGCAACCAATTCAAAGTTGG - Exonic
928056093 2:28056272-28056294 AAAAACAACCACCAAAAAATGGG + Intronic
928245662 2:29624769-29624791 AAAAACAAACACATAAAAGTAGG + Intronic
928270409 2:29850244-29850266 AAAAGCAGCAAGTTAGAAGTCGG + Intronic
928825681 2:35418446-35418468 AAAAAAACCCATTTAAAAGTGGG + Intergenic
929099027 2:38291330-38291352 AAAAGCAACCACTGATATTTAGG + Intergenic
929124994 2:38515255-38515277 ACAAACAACCAATTAAAAATGGG + Intergenic
929472351 2:42207520-42207542 AAAAGCAACAAATTAAAAAGTGG - Intronic
929734394 2:44531224-44531246 AAAGGCAACCTCTTAAGAATTGG - Intronic
930318871 2:49829558-49829580 AATATCAAACACTTAAAAGAAGG - Intergenic
931533383 2:63243359-63243381 AAAATAACCCAATTAAAAGTGGG - Intronic
931545920 2:63387274-63387296 AAAAGCTACCACAAATAAGTAGG + Intronic
931590394 2:63876557-63876579 AAAAGCAGCTAATTAAATGTAGG - Intronic
932441555 2:71739735-71739757 AAAAAAAACCATTAAAAAGTGGG - Intergenic
932959941 2:76401975-76401997 GAAAGCAACCACTTAAACAAGGG + Intergenic
933403280 2:81826065-81826087 AAAATCAACCACTTAGTAGCAGG + Intergenic
933567237 2:83965460-83965482 AAAAGCAACCACAAAAAAGCAGG - Intergenic
934844267 2:97652137-97652159 AAAAATAATAACTTAAAAGTTGG - Intergenic
935150360 2:100428696-100428718 AAAATCAACTAATGAAAAGTTGG + Intergenic
935932494 2:108143075-108143097 AAAAAAAACCATTAAAAAGTGGG + Intergenic
936808309 2:116364142-116364164 GAAAATAACCAATTAAAAGTAGG + Intergenic
937374786 2:121328710-121328732 AAAAGCAAACATTGAAAAATGGG - Intergenic
939022435 2:136975026-136975048 AAAACAAACCATTAAAAAGTGGG - Intronic
939230425 2:139418049-139418071 CAAAGAAACCACATAAAAGCAGG - Intergenic
939448061 2:142335044-142335066 CAAAGAAATGACTTAAAAGTTGG - Intergenic
939730542 2:145779310-145779332 AAAAGCAAAGACATCAAAGTGGG - Intergenic
939865199 2:147464835-147464857 AAACACAACCATTTTAAAGTGGG + Intergenic
940459600 2:153947515-153947537 AAAAAAAACCACCAAAAAGTGGG - Intronic
940931880 2:159442273-159442295 AAAAGCCACCAGCTAGAAGTGGG + Intronic
941392528 2:164932078-164932100 AAAATAAACCATTAAAAAGTAGG + Intronic
941781024 2:169445887-169445909 AAAAACAAACAGTTAAAAGATGG + Intergenic
942165350 2:173235702-173235724 AAAATTAACCATTTTAAAGTGGG - Intronic
942423106 2:175828814-175828836 AAAACAAACCAATTAAAAATTGG + Intergenic
942818479 2:180081227-180081249 AAAAGCAACCAGAAAAAAATAGG - Intergenic
943444830 2:187971687-187971709 AAAAGCAAAAATTGAAAAGTGGG + Intergenic
943841096 2:192581727-192581749 AAGAGGAACCAGTTAAAACTTGG + Intergenic
943853596 2:192760269-192760291 AAAAGCAACAATTTAAATTTTGG - Intergenic
944267711 2:197747272-197747294 AAAAGCAACCATAAAAAAGTAGG + Intronic
945369773 2:209002996-209003018 CAAAGAAACCACTCAAAGGTGGG - Intergenic
946691326 2:222310893-222310915 ATAAGGAAGCACTTTAAAGTGGG - Intergenic
948681716 2:239639698-239639720 AAAAGCAGGCACTTCAAAGGAGG - Intergenic
1168879787 20:1196552-1196574 AAAAGAAAACACTTGAAAGAGGG + Intergenic
1169948249 20:11012553-11012575 AAAAGCTAACACTTAAAATAGGG - Intergenic
1170230967 20:14045500-14045522 AAAAGCAATCAAATAAATGTTGG + Intronic
1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG + Intergenic
1172040794 20:32043932-32043954 AAAATCCACAACTTAAAAGTGGG - Intergenic
1172542837 20:35734618-35734640 AAAAGAAAACACTTGAAAATTGG + Intronic
1173739057 20:45383477-45383499 AAAAGAAACAACCTAAAAATGGG - Intronic
1175393727 20:58644221-58644243 AAAAGCAAGGACTTAACACTGGG + Intergenic
1176955793 21:15101934-15101956 TAAAGCATCTATTTAAAAGTAGG - Intergenic
1177988893 21:28014079-28014101 AAAACCAACCACATAAGACTAGG + Intergenic
1178726795 21:35060076-35060098 AAAAACAACCAATTAAAAAGTGG - Intronic
1178966362 21:37123120-37123142 AATAGCAACCACAGTAAAGTTGG + Intronic
1181498929 22:23304805-23304827 AGAAGCAAAGAGTTAAAAGTGGG + Intronic
1182397580 22:30047267-30047289 AAAAGCAACCCAATAAAAGTGGG - Intergenic
1182847570 22:33444134-33444156 AAAAGCCAGAACTTAAATGTTGG - Intronic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
950488584 3:13287949-13287971 AAAAACACCCAATTAAAAATGGG + Intergenic
950721030 3:14882711-14882733 AAAAGTCACCACTTAGAAGTTGG + Intronic
951038289 3:17958945-17958967 ATAAGCAACAACTTAAATGAAGG - Intronic
951574060 3:24095498-24095520 AGAAACAACCATTTTAAAGTAGG - Intergenic
951757370 3:26105915-26105937 AAAAGCAAGCACTTCAAAGGAGG + Intergenic
951973809 3:28480395-28480417 AAAAAAAACCATTAAAAAGTGGG - Intronic
953463311 3:43098721-43098743 AAAAGGAACCCCTTCAAAGCAGG + Intronic
953934242 3:47026276-47026298 AATGGCAATCACTAAAAAGTTGG + Intronic
955126058 3:56114033-56114055 AAAAGCAAGCACTTCAAGGGAGG + Intronic
956981829 3:74648014-74648036 TAAAGAATCCACTTAGAAGTAGG + Intergenic
957722964 3:84028715-84028737 AAAAGCAACCATTTAAATTATGG - Intergenic
957763293 3:84587958-84587980 AAAAGAACCCATTAAAAAGTGGG - Intergenic
957912372 3:86637221-86637243 AAAAAAAACCATTAAAAAGTGGG - Intergenic
958113648 3:89184982-89185004 AAAAGCACCCAATAAGAAGTTGG - Intronic
958589728 3:96140350-96140372 AAAAGAAAACAATAAAAAGTGGG + Intergenic
958655813 3:97002250-97002272 AAATGCACCCACATAAAATTAGG - Intronic
958720886 3:97841895-97841917 AAAAGCAAACAAATAAAATTTGG + Intronic
958955909 3:100465938-100465960 CAAAGACACCACTTAAAAATGGG - Intergenic
959287373 3:104433250-104433272 AAAAAAAACCATTAAAAAGTGGG + Intergenic
959385700 3:105702595-105702617 AAAAGCAACTTATTAAAAGATGG - Intronic
959845779 3:111031745-111031767 AAAAGCAAACACATTAAAATGGG + Intergenic
960743674 3:120862393-120862415 AATGGCAATCATTTAAAAGTCGG - Intergenic
961327809 3:126119790-126119812 ACAAACAACCACTAAAAACTGGG + Intronic
961410057 3:126713838-126713860 AATTGCCACCATTTAAAAGTTGG + Intronic
961982793 3:131098812-131098834 AAAAAAAAACATTTAAAAGTAGG - Intronic
963295752 3:143544501-143544523 AAAAACAACCCCATAAAAATTGG - Intronic
963782630 3:149502179-149502201 GAAAGCCACCACTAACAAGTAGG - Intronic
963951764 3:151209913-151209935 AAAAGAAACCAATTAAAATTGGG + Intronic
964460778 3:156924301-156924323 AAAATAAACCAATTAAAAATTGG - Intronic
964882440 3:161438977-161438999 CAAATAAACCACTTAAAAATAGG + Intergenic
965509059 3:169548249-169548271 AAAATAAACCACTTCAAATTAGG - Intronic
965686497 3:171308716-171308738 AAACACCACCACTTAAAAGTGGG + Intronic
966086318 3:176071193-176071215 AGAAGCAACCACTGTTAAGTTGG + Intergenic
966154811 3:176904027-176904049 AGAAGCAACCTTCTAAAAGTGGG - Intergenic
966978020 3:185103504-185103526 AAAAAAAACCATTAAAAAGTGGG + Intronic
966990982 3:185229984-185230006 ACAAGCAACCTGTTAAAAATGGG + Intronic
968247742 3:197170743-197170765 AAAAGCAAACATTGACAAGTGGG - Intronic
969383024 4:6819417-6819439 AAAAGACCCCACTAAAAAGTGGG + Intronic
970703121 4:18766673-18766695 AAAAAAAACCATTAAAAAGTGGG - Intergenic
970733026 4:19130875-19130897 AAAATTAACCAATTAAAAATGGG + Intergenic
970835715 4:20403915-20403937 AAAAGCAAACACCCATAAGTTGG + Intronic
971581686 4:28349235-28349257 AAAGGCAGCCACTTTAAAGGCGG - Intergenic
972146504 4:36033658-36033680 AAAAGCAAATAATTAAAAATGGG - Intronic
972203524 4:36744533-36744555 AAAAACAACCCATTAAAAGGTGG - Intergenic
973113143 4:46420219-46420241 AAAAGAAAATACTTAAAAGATGG - Intronic
973145936 4:46826009-46826031 AAAAGCAAAAACTAACAAGTGGG + Intronic
973554124 4:52065103-52065125 AAAAAAAACCATTAAAAAGTGGG - Intronic
974236027 4:59182232-59182254 AAAGACAACCAATTAAAAATAGG + Intergenic
974365492 4:60943513-60943535 AAAAAAAATCACCTAAAAGTAGG + Intergenic
974476974 4:62395075-62395097 AGAAGCAACCTCTGAAAAGAAGG + Intergenic
974498594 4:62666591-62666613 AAAACCAAACACTCATAAGTGGG - Intergenic
975299518 4:72774080-72774102 AAAAGCAAAAACTGACAAGTGGG - Intergenic
976139689 4:81978164-81978186 GAAAACAACCACTTGAAAATTGG - Intronic
976156042 4:82145695-82145717 AAAAAAACCCACTAAAAAGTTGG - Intergenic
977483191 4:97606120-97606142 AAAAGCACACATTTAAAAATAGG - Intronic
977697629 4:99983960-99983982 AAAAACAAACAATTAAAAATGGG - Intergenic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
977808121 4:101326848-101326870 AAAAGAAACCTCTTAAATATAGG + Intronic
977845823 4:101765430-101765452 AAAAACAACCCCATAAAAATGGG - Intronic
978628387 4:110714023-110714045 AAAAGCAACCCATTAAAAAATGG + Intergenic
978693745 4:111549764-111549786 AAAAAAAACCATTAAAAAGTAGG + Intergenic
978830467 4:113078125-113078147 GAAAGCAACCACATAAAAAATGG - Intronic
979013512 4:115401087-115401109 CAAAGCAACCACTTCAATTTTGG + Intergenic
979187577 4:117817055-117817077 AAATGCAGCTACTTAAAAATTGG + Intergenic
979315567 4:119257444-119257466 AACAGCAACAACAAAAAAGTTGG + Intronic
980197955 4:129615789-129615811 CCAAGCATCCACTTAAAAGTTGG - Intergenic
980236924 4:130120196-130120218 AAAACAAACCCATTAAAAGTGGG + Intergenic
980845102 4:138314702-138314724 AAAAGCAAAAATTTAAAAATGGG - Intergenic
981026983 4:140086678-140086700 AAACTGAACCACTTAAAGGTGGG + Intronic
981181595 4:141752098-141752120 AAAAAAAACCATTAAAAAGTGGG - Intergenic
981414463 4:144474924-144474946 AAAAGAAAACACTTATAAATTGG + Intergenic
983174684 4:164574534-164574556 AAAAGACACCACTAAAAAGTGGG + Intergenic
983351958 4:166601817-166601839 AAAAGGCACCACTCAGAAGTGGG - Intergenic
983478422 4:168243248-168243270 AAAAGCAAACACTGATAAATGGG + Intronic
983497731 4:168462469-168462491 AAAAAAACCCACTAAAAAGTGGG + Intronic
983858620 4:172676593-172676615 CAAAGCATGCCCTTAAAAGTAGG + Intronic
983996303 4:174186850-174186872 AAAAAAACCCATTTAAAAGTGGG + Intergenic
984143525 4:176033401-176033423 AAAAAAAACCATTAAAAAGTGGG + Intergenic
984213493 4:176879099-176879121 AAAAGCAAACATTTAGAAATGGG - Intergenic
984292742 4:177815770-177815792 AAAACCATCCACTTAAAAATGGG - Intronic
984720177 4:182964662-182964684 AAAAGCAACCATAAAAAAGCTGG + Intergenic
985100504 4:186453509-186453531 AAAATGAACCACTAAAAAGCTGG - Intronic
985137813 4:186805602-186805624 TAAAGGAGCCACTTCAAAGTTGG + Intergenic
985791859 5:1932745-1932767 AAAAGCAACATTTTAAAAATTGG - Intergenic
986375104 5:7122872-7122894 AAAACCAAATACTTATAAGTGGG - Intergenic
986439810 5:7770361-7770383 ATAAGGAACCACTTATAAGAGGG - Intronic
986528676 5:8709930-8709952 AAAAAAAACCATTAAAAAGTGGG - Intergenic
986807888 5:11326137-11326159 AAAAGCAAGCACTTCAAGGGAGG - Intronic
987468553 5:18302144-18302166 AAAAAAAACCATTTAAAAATGGG - Intergenic
987675494 5:21067959-21067981 AAAAGAAAACACTTTAAAATAGG + Intergenic
987782659 5:22459205-22459227 AAAAGCAAACAAATAAAAGTTGG - Intronic
988467577 5:31505335-31505357 AAAAAAAATCACTTAAAAGTAGG + Intronic
988513992 5:31889520-31889542 AAATGCATTCTCTTAAAAGTAGG + Intronic
988982083 5:36581273-36581295 AACAGCACCTACTTCAAAGTTGG - Intergenic
989019022 5:36978425-36978447 AAAACAACCCACTAAAAAGTGGG - Intronic
989285654 5:39696374-39696396 AAAAACAATAACTTAAAAATAGG - Intergenic
989324937 5:40181329-40181351 AAAAACAACCCCATAAAAGTGGG + Intergenic
989502209 5:42180540-42180562 AAAACTATCCAATTAAAAGTAGG + Intergenic
989961514 5:50421207-50421229 AAATGCAACCATCAAAAAGTGGG + Intronic
990024442 5:51168186-51168208 AAACAAAACCACTAAAAAGTGGG + Intergenic
990065670 5:51711546-51711568 AAAAGCAACAAATAAAAAGAAGG - Intergenic
990142845 5:52725408-52725430 AAAAGCAAACACTTAAGTTTGGG - Intergenic
990226098 5:53656164-53656186 AAAAGGAACCAATCTAAAGTTGG - Intronic
990230468 5:53707586-53707608 AAAAACAACCCCATTAAAGTGGG - Intergenic
990354021 5:54947839-54947861 AAAAAGACCCCCTTAAAAGTAGG + Intergenic
990388682 5:55295469-55295491 AAGAGCAGCAACCTAAAAGTAGG - Exonic
990885111 5:60582474-60582496 AAAAACAACCCATTAAAAGTAGG - Intergenic
991205984 5:64050943-64050965 AAAAGGAACCACTCAAAGATGGG - Intergenic
991213842 5:64137986-64138008 AAAAGCAACCACATATATGAGGG + Intergenic
992345841 5:75877115-75877137 AAAAGCAACCACAAGAAAGCTGG + Intergenic
993161440 5:84297194-84297216 AAAAGACACCATTAAAAAGTGGG + Intronic
993313589 5:86370216-86370238 AAAAGCAGCCATTTAAAAAATGG + Intergenic
993820566 5:92610406-92610428 AAAAAAAACCATTAAAAAGTGGG + Intergenic
994879654 5:105472986-105473008 CAAAACATCCACTTAAAAGCGGG - Intergenic
994960343 5:106594129-106594151 AAAAAAAAACACTAAAAAGTGGG + Intergenic
995329237 5:110928520-110928542 AAAAGCAAAAATTGAAAAGTGGG - Intergenic
995482512 5:112607352-112607374 AAAAGCAGGCACTTCAAAGGAGG + Intergenic
995707114 5:114997681-114997703 AAATGTAAGAACTTAAAAGTTGG - Intergenic
996120133 5:119662571-119662593 AAAAACAACAAATTAAAAATGGG - Intergenic
996830197 5:127732155-127732177 AAAAAAAACCATTAAAAAGTGGG + Intergenic
998426753 5:142035391-142035413 AAAAACAACCAATTAAAAAATGG + Intergenic
999105293 5:149065126-149065148 GAAAACAGCCACTTAAAACTGGG + Intergenic
999886458 5:155928760-155928782 AAAGGAAACAACTTAAAAATTGG + Intronic
1000030884 5:157400050-157400072 AAAAACAACTACATAAAAGGAGG + Intronic
1000459356 5:161495024-161495046 AACAGCAACCACTTTAAATAAGG - Intronic
1000809263 5:165840348-165840370 AAAAAAAAACACTAAAAAGTGGG - Intergenic
1001063564 5:168516193-168516215 AAAAGCAACTATTTAAAAGCTGG - Intronic
1001101227 5:168816150-168816172 AAAAGCAAACAACTAAAATTTGG + Intronic
1001861107 5:175056616-175056638 AAATGCAACCATGTAAAAATTGG + Intergenic
1002967708 6:1983533-1983555 AAAATAAACCATTAAAAAGTGGG + Intronic
1002972849 6:2042003-2042025 AAAAGATATCACTTAAAATTTGG + Intronic
1004060024 6:12185570-12185592 AAAAGCCACACCTTAAAAGTAGG + Intergenic
1005573478 6:27170098-27170120 AAAACAAACCAATTAAAAATTGG - Intergenic
1006183602 6:32168264-32168286 AAAACCAACCACGCAAAACTGGG + Exonic
1006265318 6:32916938-32916960 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1007570627 6:42887937-42887959 CAAAGCCATCACTGAAAAGTTGG - Exonic
1008815705 6:55562802-55562824 GAAAGAAACCACTGAAAATTGGG - Intronic
1010447246 6:75962019-75962041 AAATGCAACCAGTTAAAAACTGG + Intronic
1010602884 6:77852528-77852550 AAAAGCAAAAAAATAAAAGTTGG - Intronic
1011314205 6:86013342-86013364 AAAAACAACCCCTTAAAAAGTGG - Intergenic
1011834842 6:91419385-91419407 AAAAACAAAAACTGAAAAGTGGG + Intergenic
1011902335 6:92314207-92314229 AAAAGCAACCACTTAGCAGAAGG + Intergenic
1012637095 6:101557592-101557614 AAAAGCAAATATTTAAAAATGGG - Intronic
1012735591 6:102937263-102937285 ACAAACAACCATTTAAAAATGGG - Intergenic
1013471087 6:110466439-110466461 AAAAAAAACCATTAAAAAGTAGG + Intronic
1013572854 6:111447304-111447326 AATAGCAAGCATTTGAAAGTTGG - Intronic
1013605543 6:111744163-111744185 AAAAGCAAACATTTAACAGTAGG - Intronic
1013661730 6:112304744-112304766 ACAAACAACCATTAAAAAGTGGG - Intergenic
1013998248 6:116334712-116334734 AAAAGAAACCATTAAAAAGTTGG + Intronic
1014957440 6:127638433-127638455 AAAATCAACCACTTAAAAAAGGG + Intergenic
1015325630 6:131920013-131920035 AAAAGCAAAAATTGAAAAGTGGG + Intergenic
1015353665 6:132252046-132252068 TAAAGGCACCACTCAAAAGTGGG - Intergenic
1016259856 6:142155813-142155835 AAAAGAAACACCTTAAAACTAGG - Intronic
1016323011 6:142868386-142868408 AAGAGCAATCACTTAAATCTCGG + Intronic
1016655154 6:146510305-146510327 AAAAAAAACCACCAAAAAGTGGG - Intergenic
1016672860 6:146729072-146729094 GAGAGCAACCACCTAACAGTGGG - Intronic
1019093157 6:169556768-169556790 AAAAGAACCCAATTAAAAATGGG + Intronic
1020126383 7:5534745-5534767 AAAAACAACAACAAAAAAGTTGG + Intronic
1020346922 7:7175451-7175473 AAAAGCAACCATATATACGTGGG - Intronic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1021119891 7:16787233-16787255 AAAAGCAAGATCCTAAAAGTAGG - Intergenic
1021133154 7:16935106-16935128 AAACCCAAGCAATTAAAAGTAGG - Intergenic
1021135371 7:16958919-16958941 AAAAGCAAACATTGACAAGTAGG - Intergenic
1021370562 7:19839988-19840010 AAAAGCAAAAACTGACAAGTGGG - Intergenic
1021462735 7:20907369-20907391 AAAAGCAACCTCGAAAAAGGAGG + Intergenic
1021874514 7:25036199-25036221 AGAAGATACCACTCAAAAGTGGG + Intergenic
1021954821 7:25813785-25813807 AAAACCCACCACTTAAACTTTGG - Intergenic
1022543056 7:31157214-31157236 AAAAAAACCCACTAAAAAGTGGG - Intergenic
1022868511 7:34448869-34448891 AAAAGCAACCCCATTAAAATTGG - Intergenic
1023104643 7:36751557-36751579 TAGAGCAACCACTTAACACTTGG + Intergenic
1023126918 7:36963462-36963484 AAAAGGGACCACAGAAAAGTTGG + Intronic
1023482708 7:40651419-40651441 AAAAAAAACCATTAAAAAGTGGG - Intronic
1024489390 7:49960660-49960682 TAAACAAACCACTTAAAAATGGG + Intronic
1027364417 7:77442691-77442713 TAAAGCATCCACTAAAAAGTGGG + Intergenic
1027411321 7:77921971-77921993 AACAGAGACCACTTAAAAGAAGG - Intronic
1027659194 7:80968695-80968717 AAAAGGAACAACTTAACAGATGG - Intergenic
1027832523 7:83198109-83198131 AAAAAAAACCATTAAAAAGTGGG + Intergenic
1027863907 7:83622145-83622167 AAAAAAAAACACTTAAAAGTGGG + Intronic
1027870562 7:83701648-83701670 AAAAGCAAGTACTTAATACTGGG - Intergenic
1028043265 7:86085542-86085564 AAAAGTATTCATTTAAAAGTAGG - Intergenic
1028999631 7:97139422-97139444 CAAAGGCACCACTCAAAAGTAGG + Intronic
1029802481 7:102963896-102963918 AAAAACAACCCCATAAAAATAGG + Intronic
1030427567 7:109398509-109398531 CAAAGCAACCACTGGAATGTGGG - Intergenic
1030436360 7:109526552-109526574 CAAAGCAACTACTTAGAAGAAGG + Intergenic
1030657976 7:112189323-112189345 AAATGCAATCACTAAAAGGTTGG + Intronic
1030972202 7:116074419-116074441 AAAAGAAACCCATTAAAAATGGG + Intronic
1031173966 7:118325395-118325417 AAAAGGCACCACTCAAATGTGGG + Intergenic
1031246981 7:119326089-119326111 AAAAAAAAACACTAAAAAGTAGG + Intergenic
1031404706 7:121370541-121370563 AAAAGCAACCAACTAAAAGTAGG + Intronic
1031721146 7:125178467-125178489 AAAAGCAACCCCTAAAAATGTGG + Intergenic
1032882666 7:136105817-136105839 AAAAAAAAACACTAAAAAGTGGG - Intergenic
1033779616 7:144653047-144653069 TAAAGCAACCATTTAAAATTAGG + Intronic
1033886066 7:145947375-145947397 AAAAAAAAACATTTAAAAGTGGG + Intergenic
1034011687 7:147535446-147535468 AAAATCAACTAGTTAAAAGGTGG + Intronic
1034307362 7:150055463-150055485 AAAAGAAACCATTTAAATGAGGG + Intergenic
1034799485 7:154045224-154045246 AAAAGAAACCATTTAAATGAGGG - Intronic
1035911043 8:3566591-3566613 AAAAAAAACCATTAAAAAGTGGG + Intronic
1036097896 8:5743998-5744020 GAAAGAAACAAGTTAAAAGTTGG - Intergenic
1037230995 8:16658569-16658591 TAGGGCAACCACTTAAAAATAGG + Intergenic
1037301941 8:17461079-17461101 CAAAGACACCACTCAAAAGTGGG + Intergenic
1038032613 8:23656318-23656340 AAAAGAATCCAATTAAAAATTGG - Intergenic
1038705631 8:29891034-29891056 AAAAAAAACCATTAAAAAGTGGG - Intergenic
1040815984 8:51508934-51508956 ACAACCAACCACTTAGATGTAGG - Intronic
1040821301 8:51560943-51560965 AAAAAAAACCATTTAAAAATGGG + Intronic
1040964256 8:53068266-53068288 AAAAAAACCCACTAAAAAGTGGG - Intergenic
1041231976 8:55761998-55762020 AACACTAACCACTTAAAAATAGG + Intronic
1042154582 8:65829572-65829594 AAAAGCAACAGATTAAAAGTTGG + Intronic
1042911147 8:73827693-73827715 AAAAGAAAAAAATTAAAAGTTGG - Intronic
1043393226 8:79811276-79811298 AAAAAAAACCATTGAAAAGTGGG + Intergenic
1043677578 8:82977116-82977138 AAAAGAACCCACTTAAAAAGTGG - Intergenic
1043737901 8:83769679-83769701 AAAAGCAACAATAGAAAAGTAGG + Intergenic
1043739961 8:83799162-83799184 AAAAACAAAAACTTAAAAGCAGG - Intergenic
1043775605 8:84264435-84264457 AAAAAAAACCATTAAAAAGTGGG - Intronic
1044007243 8:86953235-86953257 AAAAGAAACAACTTAATAATTGG + Intronic
1044166120 8:88985804-88985826 TTGAGCAACCACTTATAAGTGGG + Intergenic
1044470859 8:92565517-92565539 AAAAGAAGCCAATTAAAAGTGGG - Intergenic
1044554551 8:93548822-93548844 AAAAAAAACCATTAAAAAGTGGG + Intergenic
1044700295 8:94959506-94959528 AAAAGCAACAACAAAAAAATTGG - Intronic
1044761520 8:95522552-95522574 AAAAGCAACCATTTAAGAGGTGG - Intergenic
1045623433 8:104010976-104010998 AATAGCAGCAACTGAAAAGTGGG - Intronic
1045832801 8:106484484-106484506 AAAATAAACCAATTAAAAATGGG + Intronic
1046161778 8:110376108-110376130 AAAACCAACCACCAAAAAATGGG - Intergenic
1046331189 8:112717229-112717251 AAAAACAACCCCATAAAAGGCGG + Intronic
1046523067 8:115350238-115350260 AGTGGCAACCACTTAAAAGTTGG - Intergenic
1046776474 8:118169008-118169030 AAAACCAACCACTCAACAATAGG + Intergenic
1048096664 8:131302901-131302923 AAAAAGCACCATTTAAAAGTGGG - Intergenic
1048716046 8:137271352-137271374 AAAAGAAAACATTTAAAAGTGGG + Intergenic
1048720230 8:137315291-137315313 AAATGCAACCATTAAAAATTGGG - Intergenic
1048844120 8:138590423-138590445 AACAGAAACCATTTAAAAGGAGG - Intronic
1049948659 9:623037-623059 AAAAGCAAAAACATACAAGTGGG + Intronic
1050378668 9:5000580-5000602 AAAAGAAAACTCCTAAAAGTTGG - Intronic
1050908216 9:11032021-11032043 AAATGCAACCATTTCAAAGTTGG - Intergenic
1050939682 9:11443161-11443183 CAAAGACACCACTCAAAAGTCGG - Intergenic
1051202152 9:14638680-14638702 AAAAGGTACCATTAAAAAGTGGG + Intronic
1051223749 9:14877379-14877401 GAAAGGAACAACTGAAAAGTTGG - Intronic
1051455629 9:17254312-17254334 AAAAGCAAAAACATAAAATTGGG - Intronic
1051700470 9:19817367-19817389 AAAAAGAACCAATCAAAAGTGGG + Intergenic
1051719353 9:20019883-20019905 AAAAAAAACCACCAAAAAGTGGG + Intergenic
1051857042 9:21580541-21580563 GAAACCAACCACTTAAACATCGG + Intergenic
1051916205 9:22210757-22210779 AAAATAAACAACTTAAAAATTGG - Intergenic
1052635769 9:31102232-31102254 AAAACCAAACACTCATAAGTGGG + Intergenic
1052807643 9:33026427-33026449 AAAAGCTACCAGTTGAAAGCCGG + Intronic
1053613254 9:39737162-39737184 AAAATCACCCAATTAAAAGTGGG + Intergenic
1053845269 9:42230121-42230143 AAAACCAACCCCATTAAAGTGGG + Intergenic
1053871297 9:42495110-42495132 AAAATCACCCAATTAAAAGTGGG + Intergenic
1054240261 9:62605238-62605260 AAAATCACCCAATTAAAAGTGGG - Intergenic
1054554394 9:66639764-66639786 AAAATCACCCAATTAAAAGTGGG - Intergenic
1055005713 9:71503851-71503873 AAAAGAAACCATTTAATATTAGG - Intergenic
1055217605 9:73885386-73885408 AAAAAAAACCACTAAAAAGTGGG - Intergenic
1055717959 9:79139177-79139199 ATAAGCAGACACTTAAAAATAGG - Intergenic
1056162590 9:83911527-83911549 AAAACCAAACACATAAAAGTGGG - Intronic
1056357759 9:85820001-85820023 CAAACCAAACACATAAAAGTGGG + Intergenic
1058378735 9:104355490-104355512 AAAGGCAACCACTAAAATCTTGG + Intergenic
1058826105 9:108777372-108777394 AAAAGCAAGCACTTGGAAGGAGG - Intergenic
1059013142 9:110484746-110484768 AAAAAAAACCATTAAAAAGTGGG + Intronic
1059397334 9:114045035-114045057 AAAAAAAACCAATTAAAAATGGG - Intronic
1060092468 9:120755412-120755434 AAAAAAAACCATTAAAAAGTGGG - Intronic
1060502233 9:124168285-124168307 AAAAGAAAACATTAAAAAGTGGG - Intergenic
1060729478 9:126028089-126028111 AAAAGCAACCACCTAGATGTAGG + Intergenic
1060899662 9:127246061-127246083 AGAAGCACCAACTTCAAAGTAGG - Intronic
1186372722 X:8964205-8964227 AAAAAAAACCATTAAAAAGTGGG + Intergenic
1186990995 X:15067653-15067675 AAAAAAAACCATTAAAAAGTAGG + Intergenic
1187083590 X:16018118-16018140 AAAAGTAAAGAATTAAAAGTGGG - Intergenic
1187621194 X:21057176-21057198 AAAACAAACCAATTAAAAGATGG - Intergenic
1187900492 X:24023330-24023352 AAAACCAGCCACTTTGAAGTAGG + Intronic
1187998261 X:24952786-24952808 ATCAGCCATCACTTAAAAGTTGG + Intronic
1188080583 X:25834853-25834875 AATAAAAACCACTTAAAAGGAGG - Intergenic
1188378141 X:29458279-29458301 AAAAGCAAACATTGAAAACTGGG - Intronic
1188713569 X:33432589-33432611 AAAAGAGACCACTTATAATTTGG - Intergenic
1188750812 X:33903796-33903818 AAAAGCAACAACTGACAAATGGG + Intergenic
1188846384 X:35077081-35077103 ACAAGGATCCACCTAAAAGTTGG + Intergenic
1189531160 X:41884374-41884396 GAAATCAAAGACTTAAAAGTTGG + Intronic
1189823702 X:44895439-44895461 AAAAGCAATCAATAAAAAGTTGG - Intronic
1189913147 X:45831033-45831055 ATAAGCTACAACTTAAAAGAGGG + Intergenic
1189920045 X:45894649-45894671 AAATGCTTCCACTTATAAGTGGG - Intergenic
1189949814 X:46217124-46217146 AAAAACAACCACTTAATGGCCGG - Intergenic
1190153234 X:47966177-47966199 CAAAGAAATGACTTAAAAGTTGG + Intronic
1190451949 X:50590792-50590814 AAAAATAACCAATTAAAAATGGG - Intergenic
1190898745 X:54647864-54647886 AAAAGGAAGCAATTAAAATTGGG - Intergenic
1191130336 X:57001402-57001424 ACAAGCACCAACTAAAAAGTGGG - Intergenic
1193136911 X:77982563-77982585 AAAAACAAACAATTAAAATTTGG + Intronic
1193455954 X:81731541-81731563 AAAAGCAAAAATTTAAAAATGGG + Intergenic
1193618461 X:83719737-83719759 AAAAGCAAAAATTGAAAAGTGGG + Intergenic
1193868364 X:86765057-86765079 AAAAAAATCCACTTAAAAATGGG - Intronic
1193944180 X:87711559-87711581 AAAATCAACAAAATAAAAGTTGG + Intergenic
1193986959 X:88253948-88253970 AAAAGAAATCACAAAAAAGTTGG - Intergenic
1194137625 X:90165973-90165995 AAAAGCAAAAATTTAGAAGTAGG + Intergenic
1194333128 X:92610425-92610447 AAAAGCCTCCATTCAAAAGTGGG - Intronic
1194344686 X:92749249-92749271 TAAAGCAACCACAAACAAGTAGG - Intergenic
1195249922 X:103032855-103032877 AAAAGCAAAAACTGACAAGTGGG + Intergenic
1195868955 X:109465536-109465558 ATAAGAAACCACTTACAAATTGG - Intronic
1196000155 X:110774425-110774447 AAAAGATACCACATATAAGTGGG - Intronic
1196063074 X:111432088-111432110 TGAAACAACCAATTAAAAGTGGG + Intergenic
1196553973 X:117064765-117064787 AAAAGCATAAACTTTAAAGTTGG + Intergenic
1196600343 X:117594653-117594675 AAAAAAAACCATTAAAAAGTGGG + Intergenic
1197089287 X:122517816-122517838 AAAAACAACCTCTTAAAAAATGG + Intergenic
1197575438 X:128205245-128205267 AAAAAAAACCATTAAAAAGTGGG + Intergenic
1198196098 X:134363964-134363986 AAAAGCAACTACTATAAAGCTGG - Intergenic
1198238037 X:134755277-134755299 AAGAGCTACCACTTAATAGTTGG - Intronic
1198550422 X:137739347-137739369 GAAAGAAACCATTAAAAAGTAGG - Intergenic
1198911754 X:141622678-141622700 TAAAACACCCAATTAAAAGTTGG - Intronic
1199029940 X:142985706-142985728 AAAAGTTATCACTTATAAGTGGG - Intergenic
1199488742 X:148375849-148375871 AAAAGCAAAAATTGAAAAGTGGG + Intergenic
1199588873 X:149446966-149446988 AAAAACACCCATTAAAAAGTGGG - Intergenic
1199859374 X:151787006-151787028 ACAAACAACCAATTAAATGTGGG + Intergenic
1200483412 Y:3736234-3736256 AAAAGCAAAAATTTAGAAGTAGG + Intergenic
1200641813 Y:5729450-5729472 AAAAGCCTCCATTCAAAAGTGGG - Intronic
1200653032 Y:5865890-5865912 TAAAGCAACCACAAACAAGTAGG - Intergenic