ID: 925075002

View in Genome Browser
Species Human (GRCh38)
Location 2:1009121-1009143
Sequence CTGGTCCTGGATCGTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925074997_925075002 18 Left 925074997 2:1009080-1009102 CCTAAAGCTGTGTGAGCAGCTGG 0: 1
1: 0
2: 0
3: 24
4: 241
Right 925075002 2:1009121-1009143 CTGGTCCTGGATCGTGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 65
925074996_925075002 19 Left 925074996 2:1009079-1009101 CCCTAAAGCTGTGTGAGCAGCTG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 925075002 2:1009121-1009143 CTGGTCCTGGATCGTGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925075002 Original CRISPR CTGGTCCTGGATCGTGTGTA TGG Intronic
900693511 1:3995850-3995872 CTGGTCTTGGATGGTGAGTGTGG + Intergenic
902142738 1:14370261-14370283 CTGGTCCTGGGTAGGGTGGAGGG + Intergenic
902289529 1:15427305-15427327 CTTGTCCTGGAGCGTGGGTCAGG - Intronic
903224359 1:21886459-21886481 GTGGTCCTGGGTGGTGTGTCTGG - Intronic
907737118 1:57125174-57125196 CAGGTCCTGGAGCATGTATACGG - Intronic
908759017 1:67494975-67494997 CTGATCCTGGATTGTGGTTAAGG + Intergenic
1064130526 10:12705604-12705626 CTGGTCCTCGATTGTGAGTATGG + Intronic
1065738813 10:28778160-28778182 CGGGTCCTGGATCTTGGGGAGGG + Intergenic
1069905714 10:71730977-71730999 CTGGTCCTGGAAGGCGTGGAGGG - Intronic
1069930380 10:71877785-71877807 CTGGCCCTGGATTGTGAGGATGG - Intergenic
1077347890 11:2072770-2072792 CTGCTCTTGCATCATGTGTAGGG - Intergenic
1078445301 11:11400168-11400190 CTGGGCCTGGATGGTCTGTGTGG - Intronic
1081950849 11:47041166-47041188 CTTGGCCTGGATCTTGTGTCAGG + Intronic
1085265126 11:75233053-75233075 CTGGTCCAGGCTAATGTGTAAGG + Intergenic
1091000793 11:131909652-131909674 CTGGGCCTGGTTCTTGTGCAAGG - Intronic
1113867764 13:113539199-113539221 CTGGTCCTGGGTCGTCTGCTGGG - Intronic
1113974176 13:114213689-114213711 ATGGTCCTGGAGCTTGTGCAGGG - Intergenic
1120169473 14:81234460-81234482 CTGCTCCTGGAATGTGTGCATGG + Intergenic
1125643943 15:41255188-41255210 CTAGTCCGGGATCATGTGTTGGG + Intronic
1129222581 15:74140218-74140240 CTGGTCCCAGATCTTGTGTCTGG + Intergenic
1138510582 16:57506456-57506478 CTGGTGCTGGACCCTGTGTGAGG + Intergenic
1139039029 16:62981298-62981320 GCGGTCCTGGCTCTTGTGTAAGG + Intergenic
1144052673 17:11510338-11510360 GTGGTCCTGGGTCCTGGGTAGGG + Intronic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1152161993 17:78674688-78674710 CTGGTCCAGGGTCCTGTGGAGGG + Exonic
1154077984 18:11223998-11224020 CTGGTCCTGAATATTGTGTGTGG + Intergenic
1156716739 18:40021454-40021476 CTGGTACTGGTTCCTGTGAAGGG - Intergenic
1157752054 18:50187917-50187939 CTGGGCCAGGATCCTGTTTAGGG - Intronic
1160876760 19:1300096-1300118 CTGGTCCTGGGGCGGGTGGATGG - Exonic
1164589878 19:29500835-29500857 CAGGACCTGGATGGTGAGTAAGG + Intergenic
1165792603 19:38500886-38500908 CTCTTCCTGGACCGTGTGTATGG + Exonic
1167399899 19:49258153-49258175 CTGGCCCTAGCTCATGTGTAAGG + Intergenic
1167763942 19:51468038-51468060 CTGTTACTGGATTGTTTGTAGGG - Intergenic
925075002 2:1009121-1009143 CTGGTCCTGGATCGTGTGTATGG + Intronic
929457437 2:42075822-42075844 CTGGTCCTAGGTGGTGTGTGTGG + Intergenic
931755708 2:65372241-65372263 CTGTTCCTGGACTGTGTGGAGGG + Intronic
937225808 2:120368063-120368085 CTGGTCCTGGGGGGTTTGTAGGG + Intergenic
938087154 2:128409153-128409175 CTGGTCCTGGACAGTATGGATGG + Intergenic
942008132 2:171730051-171730073 CTGGTCCTTGATTCTGCGTAGGG - Intronic
943421369 2:187672641-187672663 GCGGTCCTGGCTCTTGTGTAAGG + Intergenic
948154406 2:235769753-235769775 CTGGTCCTGGATCATGGGGGAGG + Intronic
1171251571 20:23653082-23653104 CTGGGCCTGGGTCGTGTGTGGGG - Intergenic
1175724048 20:61305113-61305135 CTGGGCCTGTATTGTGTGTGGGG + Intronic
1176426549 21:6552345-6552367 CTGGTCTGGGAGCGTGTGTGGGG - Intergenic
1179702040 21:43160667-43160689 CTGGTCTGGGAGCGTGTGTGGGG - Intronic
950423120 3:12910339-12910361 CTGCACCTGGATCATGTCTATGG - Intronic
953840899 3:46389547-46389569 GTGGGCCTGGATCCTGTGTGAGG + Intergenic
954588040 3:51753927-51753949 GTGCTCCTGGAACGTGTGCATGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
965025259 3:163293334-163293356 CTGGTCCTGGGTCCTTTGTTGGG - Intergenic
968890441 4:3365992-3366014 CTGGTCCTGGATGGGCTGCATGG + Intronic
984094198 4:175413533-175413555 CTGGTCCTGGAGGCTGTTTAGGG - Intergenic
986316798 5:6594666-6594688 ATGGTCCTGGCACATGTGTATGG - Intergenic
995681507 5:114725998-114726020 CTGGTCTTGGATTGACTGTAGGG - Intergenic
996088956 5:119331634-119331656 CTGGGCCTGGAGCATGTGTAAGG + Intronic
996529281 5:124510642-124510664 CAAGTCCTGGCTCATGTGTATGG + Intergenic
997198036 5:131992583-131992605 ATGACCCTGGCTCGTGTGTAGGG - Intronic
1000935434 5:167300078-167300100 GCGGTCCTGGCTCTTGTGTAAGG + Intronic
1001693010 5:173646776-173646798 GTGGTCATGGATCATGTGTTTGG - Intergenic
1006417963 6:33916064-33916086 CTGGTCCTTGCTCTCGTGTATGG - Intergenic
1022778578 7:33554463-33554485 TTGGTGCTGGATTGTGTGTAAGG + Intronic
1029064469 7:97835425-97835447 CTGTCCCTGCTTCGTGTGTAAGG - Intergenic
1029976524 7:104839873-104839895 GTGGTCCTGGATCATGAGTCAGG + Intronic
1038115327 8:24547542-24547564 CTGGTCTGGGATTGTGTGGAGGG + Intergenic
1038576915 8:28712392-28712414 ATGGTCCTGGTTGCTGTGTATGG + Intronic
1041648640 8:60280072-60280094 CTAGTCCGGGATTTTGTGTATGG - Intronic
1046756470 8:117977778-117977800 CTGGTCATGGGTAGTGGGTATGG - Intronic
1050934636 9:11379943-11379965 CTGGTCGTTGGTAGTGTGTAGGG + Intergenic
1055071828 9:72174526-72174548 TTGGTTCTGGATTTTGTGTATGG + Intronic
1060907178 9:127317123-127317145 CTGTTCCTGGGTGGTGTGGACGG + Intronic
1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG + Intronic
1190214595 X:48471183-48471205 CTGAACCTGGATCGTGTGTGTGG - Intergenic