ID: 925075837

View in Genome Browser
Species Human (GRCh38)
Location 2:1014926-1014948
Sequence GAACCCGAGGGGCAGCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925075837 Original CRISPR GAACCCGAGGGGCAGCCTTG AGG Intronic
900400203 1:2469905-2469927 GACCCCGAGAGGGGGCCTTGTGG + Intronic
900432426 1:2609235-2609257 CTACCCTAGGGGCAGCCATGGGG + Intronic
900587370 1:3439775-3439797 GAATCCCAGGGGCAGTCTGGGGG - Intergenic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
906935994 1:50214569-50214591 GAACCCCAGGGACAAGCTTGAGG + Intergenic
907453134 1:54560025-54560047 CATTCCCAGGGGCAGCCTTGCGG + Intronic
908246308 1:62230032-62230054 GATCACCAGGGTCAGCCTTGTGG - Intergenic
914293674 1:146298329-146298351 GAACCCGAGGAGGAACCTGGCGG + Intergenic
914554718 1:148749112-148749134 GAACCCGAGGAGGAACCTGGCGG + Intergenic
915604358 1:156941371-156941393 GAACCTGAGGAGCTGCCTGGAGG - Exonic
916346330 1:163795830-163795852 GTACCACAGGGGCAGCCTAGGGG - Intergenic
916560945 1:165933769-165933791 GAAAGCGAGGAGCAGCCTAGGGG + Intergenic
922134941 1:222815269-222815291 GAGCCCTAAGGGCAGCCTTTAGG + Intergenic
922579447 1:226686122-226686144 GAACCCAAGGGAAAGCCATGTGG + Intronic
922874422 1:228928758-228928780 GAACCCCAGAGGCAGGCCTGAGG - Intergenic
1063093619 10:2890174-2890196 GAACCCGGGAGGCAGCCTCACGG + Intergenic
1065458849 10:25934658-25934680 GAACTCGAGGGGGAGCCAGGAGG + Intronic
1065458861 10:25934697-25934719 GAACCTGAGGGGTGGACTTGAGG + Intronic
1067991273 10:51215513-51215535 GAAACTGAGGGGCAAGCTTGGGG + Intronic
1069223038 10:65907281-65907303 GCATCCGAGGAGCAGCCATGGGG - Intergenic
1069592967 10:69653098-69653120 GAACCAGAGGGGCAAACTTGTGG + Intergenic
1069820993 10:71228730-71228752 GCACCCGAGGGGCACCCACGGGG + Intronic
1071502502 10:86213714-86213736 GGACCCCAGGGGGAGCCTTGTGG - Intronic
1075160013 10:120015288-120015310 GAACCTGAGGGGCCGTCTTGGGG + Intergenic
1075753260 10:124791425-124791447 GAACCTGAGGGCCAGGCTTGGGG - Intronic
1077706324 11:4489701-4489723 GGACACGAGGGGCAGCATGGCGG - Exonic
1078658690 11:13266516-13266538 GAACCCGGGAGGCAGGGTTGTGG + Intergenic
1078722685 11:13898697-13898719 GAGCCCAAGGGGCAGACATGGGG - Intergenic
1081967483 11:47178426-47178448 GAACCCCGGTGGCAGCCTTCCGG + Exonic
1084788467 11:71457998-71458020 GAAACACAGGGGCAGCTTTGTGG + Intronic
1088422819 11:109667898-109667920 GAATCAGAGGAGCAGCCCTGTGG + Intergenic
1089127008 11:116183575-116183597 GAACCCTGGGGGCAGCCTCCAGG + Intergenic
1090282566 11:125468791-125468813 GACCCCGAGGGGCAGCATGGCGG + Intronic
1091991772 12:4961281-4961303 GAACCAGAGGGACAGCTGTGTGG - Intergenic
1096556418 12:52406739-52406761 AAAGCCTAGGAGCAGCCTTGGGG - Intergenic
1100311008 12:93394669-93394691 GAACCCGAGGAGGAACCTGGCGG + Exonic
1101765286 12:107692466-107692488 GATACGGAGAGGCAGCCTTGAGG - Intronic
1102212657 12:111138526-111138548 GAACCCTGGGGGCTGCCATGGGG - Intronic
1102225114 12:111223198-111223220 GAATCCTAGGGACATCCTTGAGG - Intronic
1103015577 12:117492155-117492177 GGACTCAAAGGGCAGCCTTGAGG - Intronic
1104747571 12:131219785-131219807 GACCCCGAGGGTCAGCCTGCTGG + Intergenic
1104849956 12:131868131-131868153 GAACCCCATGGGCTGCCTCGAGG - Intergenic
1104929307 12:132329654-132329676 GGTCCCGGGGGGCGGCCTTGAGG - Intergenic
1105279033 13:18952611-18952633 GAGCCCAGTGGGCAGCCTTGGGG + Intergenic
1108570187 13:51741961-51741983 GAAAGCAAAGGGCAGCCTTGAGG - Intronic
1113566572 13:111322982-111323004 GAACCCAAGAAGCAGCCTAGAGG + Intronic
1121283143 14:92713794-92713816 CAGCCCTTGGGGCAGCCTTGTGG - Intronic
1122043683 14:99008412-99008434 GAGCCCAAGGGGCAGCCCTTTGG - Intergenic
1122153474 14:99737090-99737112 GATCCCCAGGGGCAGTCATGTGG - Intergenic
1124422104 15:29531483-29531505 GAACATGAAGGGCAGCCCTGGGG + Intronic
1126021497 15:44406308-44406330 GAACCCGGGAGGCAGACGTGTGG + Intronic
1126985907 15:54307657-54307679 GAAGCCGATGGGCAGCCTGAGGG + Intronic
1127007215 15:54583982-54584004 GAGCCCGAGGGGAAGTCTGGAGG - Intronic
1127342758 15:58065298-58065320 CAACCCGAAGCGCAGCGTTGAGG - Intronic
1129146001 15:73648038-73648060 GAACCTGTGGGGCAGCCTACAGG - Intergenic
1129744467 15:78008334-78008356 GCACCAGAGGGGCAGCAGTGGGG - Intronic
1132095262 15:98979726-98979748 GAACCCGGGAGGCAGAGTTGCGG - Intronic
1132656264 16:1043250-1043272 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656282 16:1043294-1043316 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656301 16:1043339-1043361 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656320 16:1043384-1043406 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656339 16:1043429-1043451 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656358 16:1043474-1043496 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656377 16:1043519-1043541 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656396 16:1043564-1043586 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656415 16:1043609-1043631 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656434 16:1043653-1043675 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132656453 16:1043697-1043719 GACCCCTCGGGTCAGCCTTGGGG + Intergenic
1132809288 16:1789908-1789930 GAGCCCGAGGGGCAGCCACGGGG + Intronic
1140477270 16:75245256-75245278 GACCCGGAGGGGCAGCTCTGTGG - Intronic
1142188610 16:88706619-88706641 GAAGGCGAGGGGCGGCCTGGCGG - Intronic
1142731460 17:1861265-1861287 GAACCCGAGGTGCAGAAATGGGG - Intronic
1153523992 18:5977877-5977899 GGTACCCAGGGGCAGCCTTGGGG - Intronic
1154334844 18:13457112-13457134 GAGTCTGAGGGGCAGCCTTGGGG - Intronic
1157328524 18:46686384-46686406 GGTCCCAAGAGGCAGCCTTGTGG + Intronic
1161567484 19:5011755-5011777 CCACCCGAGGGTCAGCCCTGGGG + Intronic
1163306452 19:16482623-16482645 GCAGCGGAGGGGCAGCCCTGGGG + Intronic
1166994156 19:46711469-46711491 GAACCCGGGAGGCGGACTTGTGG - Intronic
1167867487 19:52339984-52340006 TAAACTGAGGGGCAGCCTTGTGG + Intronic
1168136636 19:54356288-54356310 GAACCTCAGGGGCAGCCTGGCGG + Intronic
1168465170 19:56595649-56595671 GAACACGAGGGCCATCCTGGGGG + Intronic
925075837 2:1014926-1014948 GAACCCGAGGGGCAGCCTTGAGG + Intronic
925314410 2:2910019-2910041 GAACCACGGCGGCAGCCTTGGGG + Intergenic
926092850 2:10061671-10061693 GAAGCTGACGGGCAGCCCTGGGG + Intronic
932217327 2:69975378-69975400 GAGGCCGAGGGGCAGCAGTGCGG - Intergenic
932735231 2:74249720-74249742 GATCCTGAGGGGCAGCCATGGGG + Intronic
932735237 2:74249743-74249765 AATCCTGAGGGGCAGCCATGTGG + Intronic
935784776 2:106538817-106538839 GGCCCCCAGGGGAAGCCTTGAGG - Intergenic
941001018 2:160203997-160204019 GCACTGGAGGGGCAGCCATGGGG - Intronic
943763737 2:191637781-191637803 GAACTCAAGAGGCAGCATTGTGG + Intergenic
1168878869 20:1189543-1189565 GATCCCCAGTGGCAGACTTGGGG + Intergenic
1170877189 20:20261494-20261516 CAAGCAGAGGGGCAGCCTAGAGG - Intronic
1172447884 20:35002654-35002676 GAGGCAGAGGGGCAGGCTTGGGG + Exonic
1174283214 20:49454179-49454201 GTACCAGTGGAGCAGCCTTGGGG + Intronic
1175922054 20:62454777-62454799 GAACCCCAGGGGCGGCCGTGAGG - Intergenic
1176114161 20:63423875-63423897 GAACCCTGGGGCCAGACTTGTGG + Intronic
1176164021 20:63663537-63663559 ATACCCGAGGGGCAGCCACGTGG - Intronic
1177120487 21:17132235-17132257 GATCCAGATGGGGAGCCTTGGGG - Intergenic
1183590642 22:38777476-38777498 CAACCAGATGGTCAGCCTTGAGG + Intronic
1185372301 22:50466561-50466583 GTCCCCGAGGGGAAGCCATGCGG + Intronic
954461448 3:50629284-50629306 GAAAGCTAGGTGCAGCCTTGGGG - Intronic
957029240 3:75221134-75221156 CAACCCTAGAGGCAGCCATGGGG - Intergenic
958037575 3:88188617-88188639 GGACTCGAGGGAAAGCCTTGGGG + Intergenic
961681864 3:128604711-128604733 GAAGCTCAGGGGCAGCCTGGTGG + Intergenic
963123154 3:141793276-141793298 AAAGCCTAGAGGCAGCCTTGGGG + Intronic
963288967 3:143467096-143467118 GAACACGAGGAGCAGCGTAGTGG + Exonic
967189902 3:186976026-186976048 GACCCTGAGGGGCTGTCTTGGGG - Intronic
968661885 4:1802075-1802097 GCAGCCAAGGGGCACCCTTGGGG - Intronic
969209276 4:5674146-5674168 GTCCCTGAGGGGCAGCCCTGAGG + Intronic
969220079 4:5753540-5753562 CCACCCCAGGGTCAGCCTTGGGG - Intronic
971385298 4:26136351-26136373 GCACCCGAGGTTCAGCATTGGGG - Intergenic
978528664 4:109692622-109692644 AAAACCGAGGGGCACCCATGAGG - Intronic
985070852 4:186165359-186165381 GAACCAGTGGGGAAGCCATGTGG - Exonic
990266707 5:54084528-54084550 GATGTCGAGGGGCAGCGTTGAGG - Intronic
992639014 5:78752555-78752577 GACCCAGAGGTGCAGTCTTGAGG + Intronic
995657417 5:114442667-114442689 AAACCCGAGGGGCAGGTTTATGG - Intronic
998374168 5:141680468-141680490 GGTCCTGAGGGGCAGCCATGGGG + Exonic
1001115065 5:168932598-168932620 CACCCCGTGGGGCAGCCTGGTGG + Intronic
1001872747 5:175170917-175170939 GAACTACAGGGGCTGCCTTGGGG + Intergenic
1002180982 5:177431049-177431071 GGAGCAGAGGGGCAGACTTGGGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1005602942 6:27446311-27446333 GAACCCCAGGAGCAGACCTGAGG - Intergenic
1006360029 6:33582320-33582342 GAACCCGGGAGGCAGAGTTGTGG + Intergenic
1006629659 6:35422023-35422045 GAGCCCTTGGGGCAGCCTAGAGG + Intronic
1010712597 6:79192665-79192687 GAACCCCAGGAGTGGCCTTGAGG + Intergenic
1011544714 6:88470480-88470502 GAAGCTGGGGGGCAGTCTTGTGG + Intergenic
1015321659 6:131881938-131881960 GAACCTGGGGGGCAGAGTTGCGG + Intronic
1017933137 6:158977755-158977777 GAACCCGAGGATGAGCCTGGTGG - Exonic
1019613075 7:1946734-1946756 GAACCCTAGGCCCAGCCTGGAGG - Intronic
1022332841 7:29396756-29396778 GAGCCCTGGGGGCAGCCTTGCGG - Intronic
1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG + Intergenic
1026027530 7:66759179-66759201 GAAACCTGGGGGCAGCCCTGGGG - Intronic
1029584943 7:101464488-101464510 GAACCCGGGAGGCAGAGTTGTGG - Intronic
1032720538 7:134547672-134547694 GAACCAAAGGGGCAGGATTGGGG - Intergenic
1034345739 7:150384201-150384223 GAGCCCGAGGGGCAGCAGAGAGG + Intronic
1034471016 7:151254344-151254366 GGATCTGGGGGGCAGCCTTGTGG + Intronic
1035386839 7:158478622-158478644 AAAACTGAAGGGCAGCCTTGGGG - Intronic
1038506925 8:28092673-28092695 GAATCCGAGGTGCAGGCTTTGGG - Intronic
1038569433 8:28647894-28647916 GAAGTCGGGGTGCAGCCTTGGGG + Intronic
1038700974 8:29849012-29849034 GAACCCTGGGGGGAGCCCTGGGG - Intergenic
1038756254 8:30343521-30343543 TAACCCAAGGGGCATCCTTGTGG - Intergenic
1042712195 8:71730571-71730593 GCAGCACAGGGGCAGCCTTGAGG - Intergenic
1045025852 8:98085788-98085810 GAACACGTGGGGAAGCCTGGAGG - Intronic
1046110058 8:109711968-109711990 GAGTTTGAGGGGCAGCCTTGTGG - Intergenic
1046498798 8:115048448-115048470 GAACCTGGGAGGCAGACTTGTGG - Intergenic
1049308869 8:141922852-141922874 GAACCGGATGGGAAGCCCTGGGG - Intergenic
1049570045 8:143365412-143365434 GAACCAGAGAGGCAGCCAGGAGG - Intergenic
1049806797 8:144544717-144544739 GACCCCATGGGGCAGCTTTGGGG + Intronic
1050480156 9:6080339-6080361 GAACCGGAGGGGCGGGATTGGGG - Intergenic
1052142190 9:25000978-25001000 GAACAGGAGGGGTAGCCTTGTGG + Intergenic
1052862541 9:33445854-33445876 GAACTGGAGGGGCAGGCCTGGGG - Intronic
1057572431 9:96214835-96214857 GAAGGGGTGGGGCAGCCTTGTGG - Intergenic
1058775586 9:108280106-108280128 AAACCAGAGGGGCAGCTTAGGGG + Intergenic
1060899526 9:127245272-127245294 CACCCCGAGGGGCCGCCTTCCGG + Intronic
1061006347 9:127930545-127930567 TATCCCGAGGGGCGGCCTGGCGG - Intronic
1061768045 9:132894986-132895008 GAGCACGTGGGGCAGCCTAGTGG + Exonic
1062219907 9:135409590-135409612 GAGCCCGAGGGGCAGGCGTCCGG + Intergenic
1062324239 9:136004758-136004780 GAGCCCGAGGGGCTGGGTTGGGG - Intergenic
1185440598 X:226027-226049 GATCCCGAGGGGAAGCGTGGGGG - Intergenic
1189320200 X:40083211-40083233 GGACCTGGGGGGCAGCCTTGGGG - Intronic
1190246394 X:48693315-48693337 GAACCCGAGAGGCAGAGTTGTGG + Intergenic
1198233291 X:134713949-134713971 GAATGAGAAGGGCAGCCTTGAGG + Intronic