ID: 925075963

View in Genome Browser
Species Human (GRCh38)
Location 2:1015850-1015872
Sequence CAGCAGATACAGATGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925075963_925075967 5 Left 925075963 2:1015850-1015872 CCCAGCATCATCTGTATCTGCTG 0: 1
1: 0
2: 1
3: 26
4: 219
Right 925075967 2:1015878-1015900 CAAGACAAAAGACTTGCAGATGG 0: 1
1: 0
2: 1
3: 28
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925075963 Original CRISPR CAGCAGATACAGATGATGCT GGG (reversed) Intronic
900242516 1:1623785-1623807 CAGCAGTCACAGATGATGTTGGG - Exonic
900958833 1:5906515-5906537 CAGCAGAGACTCATGGTGCTAGG + Intronic
904868277 1:33599945-33599967 CAGCAGATACTGCGGAGGCTGGG + Intronic
905007220 1:34719497-34719519 CAGGTGATTCAGATGCTGCTGGG - Intronic
905914922 1:41678194-41678216 CAGCAGATGCAGATGCTGCCAGG - Intronic
906208775 1:44000828-44000850 CAGGACATCCAGATGATGCTGGG - Exonic
908425013 1:63998697-63998719 CAGCAGATATTTATGTTGCTAGG + Intronic
908708766 1:66991593-66991615 CAGTAGATTCATCTGATGCTTGG + Intergenic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
911483390 1:98473999-98474021 CAGGAGATAAAGCTGATTCTAGG + Intergenic
911597216 1:99811304-99811326 CATCAGATACAGAATCTGCTGGG + Intergenic
913039459 1:115008482-115008504 CAGCAGATAGGGATGCTGTTTGG - Intergenic
914419715 1:147518229-147518251 CACCAGATACAGATTATGAAGGG - Intergenic
915626482 1:157117265-157117287 CAGCACAAACAGATGATGGCAGG - Intergenic
915981267 1:160421248-160421270 CAGCAGTTACAGAAGTTCCTTGG - Intronic
916661532 1:166926318-166926340 CAGCTGACACAGCTGATTCTTGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917155041 1:171987881-171987903 CAGAAGATACAAATAGTGCTGGG + Intronic
920854328 1:209651116-209651138 CAGCAGATACATTTGTAGCTTGG + Exonic
922854831 1:228765907-228765929 CAGGAGATAGAGATGAGGCTGGG + Intergenic
923045899 1:230355438-230355460 CAGCACATTCAGACCATGCTGGG - Intronic
923501407 1:234568079-234568101 CAGCAAATTGAGATTATGCTAGG + Intergenic
1063045526 10:2388382-2388404 CAGCACACACAGAGGATCCTTGG - Intergenic
1063045954 10:2392730-2392752 CAGCACACACAGAGGATGCTTGG - Intergenic
1063109028 10:3018981-3019003 GAGAAGATATTGATGATGCTGGG - Intergenic
1063256510 10:4333577-4333599 CAGAAGATGCAAATGATGTTAGG - Intergenic
1063281277 10:4632025-4632047 CTGAAGAAACAGATGATTCTAGG + Intergenic
1063507275 10:6611489-6611511 CAATTGATACAGATGATGTTAGG + Intergenic
1063924726 10:10966578-10966600 TAGCTGATAAAGATGGTGCTTGG + Intergenic
1064122912 10:12634902-12634924 CAGCACAAGCAGATGAGGCTTGG + Intronic
1069655680 10:70086406-70086428 CAGGGAATGCAGATGATGCTTGG - Intronic
1070409931 10:76130155-76130177 CAGTAGATACAAAAGATACTGGG + Intronic
1071786841 10:88910422-88910444 CAGTAGATCCAGATTAGGCTTGG + Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074492088 10:113947393-113947415 CAGCAGGTACTGAGGAAGCTGGG - Intergenic
1081635528 11:44718977-44718999 CAGCAGTTACACAAGGTGCTCGG - Intergenic
1083544235 11:63537224-63537246 CAGCAGAAGCAGACGATGTTGGG - Intronic
1084062213 11:66683604-66683626 CCGCATATGCAGATGCTGCTCGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084624769 11:70297787-70297809 CAGCAGATGCAGGAGAGGCTGGG + Intronic
1087064829 11:94018263-94018285 TAGCAGAGAAAGATAATGCTGGG - Intergenic
1090454053 11:126832183-126832205 CAGCACATAAGGATGATCCTAGG + Intronic
1090810124 11:130231947-130231969 CAGCATATACAGGTTATGATAGG - Exonic
1095481117 12:42637076-42637098 CAGCAGTTACCGTTGCTGCTGGG - Intergenic
1095745720 12:45656404-45656426 CAGAAGAAAGAGATGATGCAAGG + Intergenic
1096749462 12:53749475-53749497 CATCAGGTAAACATGATGCTGGG - Intergenic
1097341228 12:58440406-58440428 AAGCAAATACATATGATTCTAGG + Intergenic
1098404857 12:70113872-70113894 CAGTAGATAAAAATGATGTTAGG + Intergenic
1100308555 12:93373408-93373430 CTGCATATAAACATGATGCTTGG + Intergenic
1104182251 12:126393456-126393478 CATCAGGTAGAGAGGATGCTGGG + Intergenic
1107680560 13:42844422-42844444 CAGCAAATGCAGATTATGATAGG - Intergenic
1108372985 13:49789492-49789514 CAGCTGATACACAAGATGTTAGG - Intronic
1109692311 13:65909674-65909696 CAGAGTAAACAGATGATGCTTGG - Intergenic
1110380155 13:74841140-74841162 CAGGAGATACAGATGATTGTTGG - Intergenic
1113395892 13:109947270-109947292 CATCAGACACAGAACATGCTGGG - Intergenic
1114629373 14:24149344-24149366 CAGCAGATTCAGATGTAGCCTGG + Intronic
1116801363 14:49447369-49447391 CAGCAAATGCAGAGGATGCTTGG - Intergenic
1116814346 14:49569742-49569764 CAGGAGATACAAATGAGGCTTGG + Intergenic
1117021497 14:51575441-51575463 CTGCAGATGCAGATGCTCCTTGG + Intronic
1117463405 14:55968995-55969017 GGGCAGATACAGATGAAGGTTGG + Intergenic
1117745824 14:58868527-58868549 AAGAAGAGACAGAAGATGCTGGG - Intergenic
1118813201 14:69290445-69290467 CACCAAACACAGATGATTCTGGG - Intronic
1121456090 14:94039718-94039740 CAGGAGATGCTGATGCTGCTGGG + Intronic
1123476269 15:20594180-20594202 CAGAAGAGTCAGAAGATGCTGGG - Intergenic
1123514784 15:21023971-21023993 CAGCAGAGTCAGATGTTTCTGGG + Intergenic
1123641743 15:22406184-22406206 CAGAAGAGTCAGAAGATGCTGGG + Intergenic
1124444687 15:29719947-29719969 CAGCAGAGGTTGATGATGCTGGG + Exonic
1126117380 15:45220907-45220929 CAGCAGATACAAACGAAACTAGG - Intergenic
1128288287 15:66456802-66456824 TAGCAGAAACAGTTGATGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133698160 16:8284716-8284738 CAGGAGCTGCAGATGAGGCTGGG + Intergenic
1134361593 16:13535867-13535889 TAGCAGATCCAGATTATTCTAGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1136924492 16:34359413-34359435 CAGCAGATCAAGATCATGCCAGG - Intergenic
1136980081 16:35052393-35052415 CAGCAGATCAAGATCATGCCAGG + Intergenic
1140056634 16:71531285-71531307 CAGCAGAGGCAGATGCTCCTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141898000 16:86970951-86970973 CAGCAGAGCCATATGGTGCTGGG - Intergenic
1144642300 17:16944244-16944266 CAGCATGTACAGGTGCTGCTAGG - Intronic
1145206831 17:20988986-20989008 CAGCACTTACAGGTGCTGCTAGG + Intergenic
1147246671 17:39125749-39125771 CAGCTGTTACAAATGATGTTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151878687 17:76881664-76881686 CAGAAGATTCAGATGCTGCTGGG + Intronic
1153410195 18:4783767-4783789 CAGCAGATAGAGATATTGCAGGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156516503 18:37684853-37684875 CAGCATTTAAGGATGATGCTGGG - Intergenic
1161958357 19:7508468-7508490 CAGCCCATCCAGAGGATGCTTGG + Intronic
1163687319 19:18719226-18719248 CAGCAGACACACACGATGCAGGG - Intronic
1163740019 19:19005929-19005951 CAGCAGAAACAAATGAATCTGGG + Intronic
1163864885 19:19764711-19764733 TGGCAGATACAGATGATCTTTGG + Intergenic
1166097547 19:40550449-40550471 CAGCAGATACAGATGTATCCAGG + Intronic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
925799629 2:7585426-7585448 CAGCAACTTTAGATGATGCTAGG - Intergenic
928306276 2:30172674-30172696 CGGCAGATCCAGTTGAGGCTGGG - Intergenic
930148887 2:48037668-48037690 CAGCTAATACAGATGATGAAAGG - Intergenic
930994375 2:57698589-57698611 CAGCAGACTCAGAGGATGCAGGG + Intergenic
931188733 2:59979099-59979121 CAGCATGTATAAATGATGCTAGG - Intergenic
933600283 2:84321931-84321953 CAGGAGATGCTGATGCTGCTGGG + Intergenic
935674731 2:105584915-105584937 CAGCAGATGAAACTGATGCTGGG + Intergenic
936299588 2:111294592-111294614 CAGCAGTTACACAGGATTCTAGG - Intergenic
937027691 2:118712775-118712797 CAGAAGATCCAGAAGATACTGGG - Intergenic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
939507669 2:143069443-143069465 CTGCAGCTACAGAGCATGCTAGG + Intergenic
943492271 2:188569622-188569644 CAGCAGAAGCAGCAGATGCTGGG + Intronic
944338466 2:198566020-198566042 CCCCAGAAACAGATGCTGCTAGG + Intronic
945662812 2:212707249-212707271 CTGCAGATATAGATTATGATAGG - Intergenic
946660798 2:221997479-221997501 CAGCAGGTACAGAGAATGGTAGG - Intergenic
1168884018 20:1232256-1232278 CAGGAGACACAGATGATGTAGGG + Intronic
1169543525 20:6627713-6627735 CAGTACTTACAGCTGATGCTGGG + Intergenic
1170357173 20:15505547-15505569 CAGCCCACAGAGATGATGCTGGG - Intronic
1172342625 20:34170342-34170364 CAGCAGATACAGAGAAGACTGGG - Intergenic
1175544542 20:59769719-59769741 CAGCAAGTGCAGATGATGGTTGG + Intronic
1177083290 21:16669312-16669334 CAGCAGATACAGCTGTTTCTAGG + Intergenic
1178161427 21:29920693-29920715 TAGCAGATACTCATGAAGCTTGG + Intronic
1178414053 21:32389506-32389528 CAGCAGGGACTGATGATGCCTGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181300674 22:21878651-21878673 CAGGAGTTACAGATCATCCTGGG + Intergenic
1181609584 22:24003719-24003741 AAGCAGAGACAGATGGTGCAAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1185144672 22:49124873-49124895 CAGGAGAGACAGAAGATCCTGGG + Intergenic
949383266 3:3469348-3469370 CAGAGGAAACACATGATGCTGGG + Intergenic
950430045 3:12945307-12945329 CAGCAGGTCCAGAACATGCTTGG + Intronic
951380449 3:21977608-21977630 CAGGAGCTAGAGATGATCCTGGG + Intronic
951966105 3:28387042-28387064 AAGCAGAGAGAGCTGATGCTGGG - Intronic
953920414 3:46947667-46947689 CAGCAGATAGAGTGGATACTCGG - Intronic
956044707 3:65183185-65183207 CAGGAGATAGAGATCATCCTGGG - Intergenic
958487695 3:94732589-94732611 CAGCAGATAGGGATGCTGTTTGG - Intergenic
959439495 3:106359067-106359089 TAGCAGATAGAGATGCTGTTTGG + Intergenic
960398078 3:117161569-117161591 CACACAATACAGATGATGCTGGG - Intergenic
961269139 3:125675182-125675204 CAGCAGCTACAGGTGATGCAAGG - Intergenic
962560722 3:136603672-136603694 CAGCAGATCGAGATCATCCTGGG + Intronic
963801646 3:149682204-149682226 CTGCAGATACCAATGATGGTTGG - Intronic
965466037 3:169031754-169031776 CAGCAGCCACTGATGATGCAGGG - Intergenic
967823024 3:193855857-193855879 GGGCAGATTCAGATGAAGCTGGG + Intergenic
967890569 3:194361543-194361565 CAGCACATTCAGATGATGTGAGG - Intronic
970275181 4:14391981-14392003 AAGCAGAGACAGAGCATGCTGGG - Intergenic
970473591 4:16400549-16400571 CAAATGATACAGATGATGCCAGG - Intergenic
972103742 4:35456051-35456073 TAGCAGATACTGGTGAGGCTTGG - Intergenic
972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG + Intronic
972958476 4:44421775-44421797 CATCAGAAACAGATGTTGCATGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
976103668 4:81593347-81593369 CACCAAATTCAGATGGTGCTTGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978977200 4:114892668-114892690 CAGCAGATACAGTTCCTTCTTGG - Intronic
979221044 4:118225233-118225255 CAGCATATTCAGATGACTCTGGG + Intronic
979880030 4:125943830-125943852 CAGCAGACAGAGATGCTTCTGGG + Intergenic
980327297 4:131363610-131363632 GAGCAGATACATATGAAGGTAGG + Intergenic
983618808 4:169737685-169737707 CAGTAGATAAAAATGATGTTGGG - Exonic
984946897 4:184975850-184975872 CACAAGACACAGAGGATGCTGGG - Intergenic
987657152 5:20821766-20821788 CAGCAGATAAGGATGCTGTTTGG - Intergenic
987885428 5:23806385-23806407 TGGCAGATACGGATGCTGCTTGG + Intergenic
988766399 5:34382182-34382204 CAGCAGATAAGGATGCTGTTTGG + Intergenic
988936765 5:36091190-36091212 CACCAGATACAAAGGATCCTGGG + Intergenic
990198023 5:53340911-53340933 CAACTGATAGAGATGATGCCTGG + Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
992381917 5:76246000-76246022 CAGCATATAGAGATTATGGTTGG + Intronic
992909784 5:81384743-81384765 AAACATTTACAGATGATGCTTGG + Intronic
993878394 5:93336028-93336050 CAGCAGACACTGAAGCTGCTGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995188926 5:109299807-109299829 CGGCAGACTCAGATGCTGCTTGG - Intergenic
995232175 5:109779471-109779493 CAGCAGATACAGATGAGCTCAGG - Intronic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
995775251 5:115718107-115718129 CAGCAGAGTCAGATGTTGCTTGG + Intergenic
996435218 5:123426594-123426616 AAACAGATATAGATGATGATAGG - Intergenic
996533590 5:124552147-124552169 CAGGAAATACAGTTGGTGCTGGG - Intergenic
997596762 5:135112226-135112248 GAGCAGAGACAGATGTGGCTGGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1001329731 5:170753886-170753908 CAGCAGGTACAGATGACACCTGG + Intergenic
1002561599 5:180086040-180086062 CAGCAGATAAAAATGATGTTGGG - Intergenic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1005490595 6:26343851-26343873 CAGCTGATAGGGCTGATGCTGGG - Intergenic
1005655709 6:27934810-27934832 CAGTAGGTACAGATGATGCCAGG + Intergenic
1006096412 6:31659378-31659400 CAGCAGCTCCAGAAGATGCAGGG + Exonic
1006876529 6:37302204-37302226 CAGCAGATAAAGAAGCTGCTTGG - Intronic
1007520352 6:42447198-42447220 CTGAAGAAACAGATGATTCTTGG - Intronic
1011428375 6:87256277-87256299 TAGCAGATAGAAGTGATGCTTGG + Exonic
1012030682 6:94057944-94057966 CAGGAGATAGAGATGAGCCTTGG + Intergenic
1012134969 6:95544351-95544373 ATGCAGATAAAAATGATGCTTGG + Intergenic
1013503614 6:110776632-110776654 GAGAAGATACAGCTGAGGCTGGG - Intronic
1015690828 6:135920858-135920880 CAGCACTTACTGATGAAGCTAGG - Intronic
1017552542 6:155524572-155524594 CAGGAGATGCTGATGCTGCTGGG - Intergenic
1017692660 6:156982827-156982849 CAGAAGAAACAGATAATGCAAGG - Intronic
1018605801 6:165596518-165596540 CAGCAGTTCCAGACCATGCTGGG + Intronic
1019632124 7:2055079-2055101 CAGCAGAGACAGAGGAAGCGGGG + Intronic
1020270737 7:6593857-6593879 CAGCAGTTCCAGATGAGCCTGGG - Intronic
1020411292 7:7894735-7894757 GAGCAGATACAGAAGATGTAGGG - Intronic
1023174204 7:37419960-37419982 CAGCAATTACAAATGATGATAGG - Intronic
1023235099 7:38077443-38077465 CATCAGAAAAAGATGATACTAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026646268 7:72172012-72172034 CAGCAGATAGAGATGCTGCTGGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1033247480 7:139729997-139730019 CAGCAGATACTGAGGAGGCCAGG + Intronic
1033723556 7:144087174-144087196 TAGCAGAAGCAGATGATTCTCGG - Intergenic
1033959851 7:146901235-146901257 CAGCAGAAACTGTTGAGGCTCGG - Intronic
1034144473 7:148856589-148856611 CTGCAGAAACAGCTGATTCTAGG + Intronic
1034340908 7:150354423-150354445 CAGGAGAGACGGATGAAGCTGGG - Intergenic
1034941126 7:155231100-155231122 CAGCCGTTACAAATCATGCTGGG + Intergenic
1034959344 7:155355352-155355374 CAGCAGATGCAGAAGATGGGAGG + Intergenic
1035935360 8:3831375-3831397 CAACAGAGACAAATGATTCTTGG + Intronic
1036080309 8:5548043-5548065 CAGCATATACACATGGTGCAAGG - Intergenic
1036284420 8:7431116-7431138 CATCAGAGAAAGAGGATGCTGGG + Intergenic
1036337056 8:7880414-7880436 CATCAGAGAAAGAGGATGCTGGG - Intergenic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039434246 8:37548687-37548709 AAGGAGATTCAGATCATGCTTGG - Intergenic
1040775926 8:51043313-51043335 CAGCAGAGCTAGATGATGCTGGG - Intergenic
1040794841 8:51278126-51278148 CAGGAGATACTGATAATACTAGG - Intergenic
1041130621 8:54695824-54695846 AAGCACTTACAGATGATCCTGGG - Intergenic
1041606272 8:59785804-59785826 CAGCAGATACTGATGGTGACAGG - Intergenic
1041701969 8:60800464-60800486 CAGATGATGCAGATGCTGCTGGG + Exonic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044467323 8:92523005-92523027 CAGCTGAGACTGAAGATGCTTGG + Intergenic
1045185448 8:99832501-99832523 CTTCAGAAACAGATCATGCTGGG + Exonic
1045495248 8:102702606-102702628 CAGCACAAACAGATAAAGCTGGG - Intergenic
1047243127 8:123112062-123112084 CAGGAGATCCAGATGAGCCTGGG - Intronic
1050379258 9:5009568-5009590 CAGAAGAAACAGATAATGCAGGG - Intronic
1050527152 9:6555966-6555988 CAGCTGATAAAGCTGATGCCAGG + Intronic
1052512774 9:29442402-29442424 CAGCAGAGAGAAATGATTCTGGG + Intergenic
1052592105 9:30511735-30511757 TATGAGATAGAGATGATGCTGGG + Intergenic
1053891810 9:42701334-42701356 CAGGAGATCAAGATGATCCTGGG + Intergenic
1055094472 9:72397535-72397557 GAGCAGATGAAGATGATGCTTGG - Intergenic
1055698475 9:78915900-78915922 CAGGTGATACTGATGATTCTTGG + Intergenic
1057147837 9:92770415-92770437 CAGCGGATACAGACCAGGCTGGG + Intergenic
1058587586 9:106527294-106527316 CAGCAGATACTGATCATGTTGGG - Intergenic
1059802606 9:117765295-117765317 CAGGTGGTACTGATGATGCTGGG + Intergenic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1061790254 9:133055375-133055397 CAGCAGAGACGGGTGATGCGAGG + Intronic
1185702728 X:2243291-2243313 CCGCAGGTACAGATGCTGCTGGG - Intronic
1186019693 X:5240178-5240200 CAGGGGATACATATGATGATTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186610002 X:11129778-11129800 CAGGAGATGCTGATGCTGCTGGG + Intergenic
1186837325 X:13450677-13450699 CAGGTGATACTGATGCTGCTGGG + Intergenic
1187416090 X:19094692-19094714 GAGCAGGTAGAGTTGATGCTGGG - Intronic
1187677536 X:21732685-21732707 CAGGATAAACAGAAGATGCTAGG + Intronic
1187767192 X:22655282-22655304 CAGGTGATGCTGATGATGCTGGG + Intergenic
1187787977 X:22914874-22914896 CAGCAGACACATAGCATGCTGGG + Intergenic
1188960438 X:36484766-36484788 CAGTAGATACAAATGTTGCCAGG + Intergenic
1190215832 X:48478871-48478893 CAGCAGAAAATGATGATGCTGGG + Intronic
1191832740 X:65432438-65432460 TAGCAGATAGAGATGCTGTTTGG - Intronic
1196008155 X:110857209-110857231 CAGGTGATACTGATGCTGCTAGG - Intergenic
1196736361 X:118984163-118984185 CAGGTGAGACAGATGAAGCTGGG + Intronic
1199040574 X:143110983-143111005 CAGCAGATAGGGATGCTGTTTGG + Intergenic
1199543776 X:148986010-148986032 CAGCACATACAGATGATTTGGGG - Intronic
1199977919 X:152905223-152905245 CAGCAGAAACAGATGCTGAGAGG - Intergenic
1200109244 X:153731315-153731337 CAGCAGCTACAGAAGAAGCAGGG - Intronic
1200894982 Y:8365951-8365973 CAGCAGATTCAGAGGAGACTAGG - Intergenic