ID: 925076348

View in Genome Browser
Species Human (GRCh38)
Location 2:1019456-1019478
Sequence CCATAGGTGTGCTGGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925076348 Original CRISPR CCATAGGTGTGCTGGGAATG TGG Intronic
900544846 1:3222747-3222769 CCACTGCAGTGCTGGGAATGGGG - Intronic
900943230 1:5814589-5814611 GCCTAGGCGTGCTGGGAAAGGGG + Intergenic
902183563 1:14708253-14708275 CCAGAGGTGTGGTTGGAATCAGG + Intronic
903827417 1:26156123-26156145 CCCAAGGTGATCTGGGAATGAGG + Intergenic
906214393 1:44030544-44030566 CCCTAGGTGTGCCGGTAATGAGG + Intronic
906764688 1:48417956-48417978 CCATAGGTGTCCTGGCTTTGAGG - Intronic
907735078 1:57104468-57104490 GAAAAGGTGTGCTGGGAATTAGG + Intronic
910479383 1:87641710-87641732 CCCTAGTTCTGCTGGGCATGGGG - Intergenic
914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG + Intronic
914999097 1:152571841-152571863 CCACAGTCCTGCTGGGAATGTGG + Intronic
915490152 1:156246234-156246256 CCCTAGGTGTTCTGGGAAGATGG - Exonic
917611360 1:176692226-176692248 CCATAGGTGGAATGGGGATGGGG - Exonic
917979462 1:180260041-180260063 CCAAGGGTGTGGTGGGAGTGAGG + Intronic
918038205 1:180895892-180895914 CCACAGGTGTGCTCTGAAAGGGG - Intergenic
919805521 1:201379060-201379082 CCACAGATGTGCTGGCAGTGTGG - Intronic
920240746 1:204547590-204547612 ACAGTGGTGTGGTGGGAATGGGG - Intronic
921186997 1:212678706-212678728 CCATGGGTTTGCTGGAAAAGAGG - Intergenic
922241224 1:223756565-223756587 CCAGGGGTGTGCTGGGAAACTGG - Intronic
922607918 1:226902414-226902436 CCTGGGGTGTTCTGGGAATGGGG + Intronic
922743385 1:228029419-228029441 CCACAGCTGTGCTGAGCATGTGG + Intronic
923515939 1:234698199-234698221 CCACAGTGGTGGTGGGAATGTGG - Intergenic
924781826 1:247156903-247156925 CCTTATGTGTGCATGGAATGTGG - Exonic
1066576329 10:36829251-36829273 CCCTAGTTGTGGTGGGAAGGGGG + Intergenic
1069635000 10:69919696-69919718 CCCCAGGTTTGCTGGGAAAGAGG + Intronic
1070357843 10:75657965-75657987 ACAGATGTGAGCTGGGAATGTGG + Intronic
1070806197 10:79272386-79272408 ACGTAGGTGTGAAGGGAATGAGG + Intronic
1071480716 10:86062780-86062802 CCAGACGGGTGCTGGGCATGGGG - Intronic
1074106794 10:110394641-110394663 CCACAGATGTGCTTGGAAGGGGG + Intergenic
1074352469 10:112751252-112751274 AGAAAGGTTTGCTGGGAATGTGG + Intronic
1075633889 10:124017540-124017562 CCAGTTGTGTGCTTGGAATGAGG - Intronic
1077191784 11:1258748-1258770 CCACAGGTGGGCAGGGAATCTGG - Intronic
1077405741 11:2381790-2381812 CCAGAGGGGTGCTGGGAACAAGG - Intronic
1078659783 11:13277694-13277716 CCATTGGTGGGCGGGGAAGGGGG + Intronic
1079719324 11:23790328-23790350 CCTTATGTGTGCAGGGATTGTGG + Intergenic
1080459597 11:32441679-32441701 CTAAAGGTGAGATGGGAATGAGG + Intergenic
1080724324 11:34880443-34880465 ACATAGGTGTTCAGTGAATGAGG - Intronic
1082664102 11:55951738-55951760 GAGTAGGTGTGCTGGGCATGAGG + Intergenic
1082780575 11:57284364-57284386 CCATAAGTGTGCTCTGGATGTGG + Intergenic
1083853191 11:65379510-65379532 CCACAGCTATGCTGGCAATGGGG + Exonic
1083947088 11:65929863-65929885 CCTCAGGTGCACTGGGAATGTGG - Intergenic
1085343194 11:75747119-75747141 CCATAGGTGTGCAGGAACTATGG + Intergenic
1088421618 11:109654851-109654873 CAATAGATGTGCTAGGCATGAGG + Intergenic
1088843402 11:113645057-113645079 ACATGGGTGTGCTGGGAGTGAGG + Intergenic
1090356535 11:126144245-126144267 CCAAAGCTGGGCTGGGAAAGAGG + Intergenic
1090398992 11:126436374-126436396 GCATGGGTGTGCTGGGAACCTGG - Intronic
1092143917 12:6201624-6201646 TCATGTGTGTGCAGGGAATGTGG - Intronic
1092392761 12:8095840-8095862 ATATAGTAGTGCTGGGAATGGGG + Intronic
1096729405 12:53595749-53595771 CCCTAGTTGTGATGGGATTGAGG - Intronic
1101708153 12:107240139-107240161 CCAGAGGTCTGCTGTGAAGGTGG + Intergenic
1102161479 12:110772529-110772551 TCATAGGTGTTTTGGGAAAGGGG + Intergenic
1102511712 12:113420630-113420652 CCATAGGGTAGCTGGGGATGGGG - Intronic
1103037511 12:117668290-117668312 CCGTGGGTGGGCTGGGAAGGAGG - Intronic
1105051656 12:133058255-133058277 CCATATGTATGCAGTGAATGTGG + Exonic
1105066362 12:133202761-133202783 CCCTATGAGTGCTGTGAATGTGG + Intergenic
1105066458 12:133203853-133203875 CCACATGAGTGCAGGGAATGCGG + Intergenic
1105552799 13:21413270-21413292 CCAAAAGTGTGCTAAGAATGGGG - Intronic
1106759735 13:32857066-32857088 CCAGGTGTGTGCTGGGCATGTGG + Intergenic
1109579001 13:64301242-64301264 CCATATGGGTGCTGGGACTAAGG - Intergenic
1111879603 13:93939278-93939300 CCACATGTGTGTTGGGAATAAGG + Intronic
1112847524 13:103662623-103662645 CCATAGGTATGCTGGAGAGGGGG - Intergenic
1113955098 13:114096099-114096121 GCATCGGTGTGCTGGGAAGGGGG + Intronic
1114530535 14:23392798-23392820 CCTTGGGTATGCTGGGAATAAGG - Intronic
1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG + Intergenic
1120343661 14:83255377-83255399 ACACTGATGTGCTGGGAATGTGG - Intergenic
1120593506 14:86405084-86405106 TCATAGGTGTGGAGGCAATGGGG + Intergenic
1121081827 14:91114650-91114672 CCACAGGCTTGCTGGGGATGAGG + Intronic
1121441972 14:93955226-93955248 GCGTGGGTGTCCTGGGAATGAGG - Intronic
1122443975 14:101755760-101755782 CCATCGGTGTGCAGGGAGGGGGG - Intergenic
1122656894 14:103268075-103268097 CCACAGCTGTGGTGGCAATGGGG + Intergenic
1122693970 14:103543980-103544002 CCAGAGGTGTCCTGGCCATGCGG + Intergenic
1202830162 14_GL000009v2_random:19326-19348 CCCTAGGTGGGCGGGTAATGAGG + Intergenic
1123466905 15:20523953-20523975 CCATTGGTGTCCTGGGCAGGTGG + Intergenic
1123651208 15:22477089-22477111 CCATTGGTGTCCTGGGCAGGTGG - Intergenic
1123741618 15:23285931-23285953 CCATTGGTGTCCTGGGCAGGTGG - Intergenic
1123745379 15:23316627-23316649 CCATTGGTGTCCTGGGCAGGTGG + Intergenic
1123989038 15:25669648-25669670 CTATACGTGTGCTCGGTATGCGG - Intergenic
1124277652 15:28339944-28339966 CCATTGGTGTCCTGGGCAGGTGG + Intergenic
1124305048 15:28571661-28571683 CCATTGGTGTCCTGGGCAGGTGG - Intergenic
1124427885 15:29577921-29577943 GCAGAGGGGTGGTGGGAATGGGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124846833 15:33299669-33299691 CCATAGCTGTGTTGATAATGAGG + Intergenic
1125078921 15:35653887-35653909 CCATTGCTTTGCTGGGGATGTGG + Intergenic
1125591329 15:40856307-40856329 GCTTACCTGTGCTGGGAATGGGG - Exonic
1126792469 15:52233730-52233752 ATATGGGTGTGTTGGGAATGTGG - Intronic
1130984827 15:88837932-88837954 CAAAAGATCTGCTGGGAATGGGG - Intronic
1132380002 15:101359698-101359720 GCACAGGTGTGCAGGGCATGCGG + Intronic
1132464214 16:70327-70349 CCAGACGTGTGCAGGGGATGTGG - Intronic
1134558524 16:15187280-15187302 CCAGAGCTGTGTTGTGAATGGGG - Intergenic
1134919055 16:18098882-18098904 CCAGAGCTGTGTTGTGAATGGGG - Intergenic
1135296922 16:21287716-21287738 CCATCGGTGTGCTGGGAGGGTGG + Intronic
1137402548 16:48165147-48165169 CCACAGCAGTTCTGGGAATGGGG + Intergenic
1137599153 16:49744328-49744350 CCACATGTGTGCTGAGCATGGGG - Intronic
1139651354 16:68363760-68363782 CCATCGGTGAGCTGGGGCTGGGG - Exonic
1141363506 16:83419720-83419742 CCATAAGTGTACTGGCATTGTGG + Intronic
1144334876 17:14259632-14259654 CCATAGCTGTGGTGGGCATCTGG - Intergenic
1146525437 17:33563485-33563507 CCAGTGGTGGGCTGGGGATGGGG - Intronic
1146663959 17:34684195-34684217 CCATAGTTGGGGTGGGGATGGGG - Intergenic
1148072438 17:44916177-44916199 CCAGGAGTCTGCTGGGAATGAGG - Intronic
1149650943 17:58276040-58276062 CCATATGTGTGCTAGGAGGGAGG - Intronic
1150787452 17:68174442-68174464 CCATCAGTGTGCTGTGTATGTGG - Intergenic
1151750728 17:76036064-76036086 CCCTAGGTCTGCTGTGGATGTGG - Intergenic
1152244893 17:79180217-79180239 CCCTAGGTAGGCTGGGGATGGGG - Intronic
1152306604 17:79524620-79524642 CCCTGGCTGTGCTGGGAGTGTGG + Intergenic
1153793148 18:8597922-8597944 CTACAGGTGTGCAGGCAATGGGG + Intergenic
1160113263 18:76053995-76054017 CCATGGGTGTACGGGGTATGTGG - Intergenic
1162199132 19:9008619-9008641 CCAGAGGGGTGATGGGGATGGGG + Intergenic
1162677219 19:12308180-12308202 ACATAGCAGTGCTGGGAAGGCGG - Intergenic
1163056049 19:14719008-14719030 CCCTATGTGTGCCAGGAATGTGG + Exonic
1163815978 19:19464796-19464818 CCAGAGGTGAGCAGGGAGTGAGG + Intronic
1165262733 19:34634827-34634849 CCCTATGTGTGCAGCGAATGTGG - Intronic
1165297951 19:34943657-34943679 CCATATGAGTGCGGGGAATGTGG + Exonic
1165299368 19:34958908-34958930 CCGTATGAGTGCTGTGAATGTGG - Exonic
1165638311 19:37362693-37362715 CCTTATGTGTGCAGGGAATGTGG + Exonic
1165638331 19:37362861-37362883 CCTTATGTGTGCAAGGAATGTGG + Exonic
1165638346 19:37362945-37362967 CCTTATGTTTGCAGGGAATGTGG + Exonic
1165712996 19:38025323-38025345 CCATGAGTGTGCTGGGATTGTGG + Intronic
1165949970 19:39468871-39468893 CCAGAGGGGTGTTGGTAATGGGG + Intronic
1166349895 19:42191722-42191744 CCACAGGTGTGATGGCAGTGAGG + Intronic
1167816949 19:51891333-51891355 CCATACGGGTGCAGTGAATGTGG - Exonic
1168460720 19:56554799-56554821 CCATATGAGTGCAAGGAATGCGG + Exonic
1168546412 19:57254095-57254117 CCATATGTGTGTAGTGAATGCGG + Exonic
1168557754 19:57357541-57357563 CCTTATGTGTGCAGTGAATGTGG + Exonic
1168563038 19:57399209-57399231 CCGTATGAGTGCAGGGAATGTGG + Exonic
1168571342 19:57473425-57473447 CCTTATGTGTGCAGTGAATGTGG - Exonic
1168571354 19:57473593-57473615 CCATATGAGTGCAGCGAATGTGG - Exonic
1168574090 19:57493833-57493855 CCTTATGAGTGCAGGGAATGTGG + Exonic
1168574107 19:57494001-57494023 CCTTATGAGTGCAGGGAATGTGG + Exonic
1168575748 19:57507335-57507357 CCTTATGAGTGCAGGGAATGTGG + Exonic
1168587651 19:57606741-57606763 CCTTATGTGTGCAGTGAATGTGG + Exonic
1168589528 19:57621314-57621336 CCATATGAGTGCAGTGAATGTGG + Exonic
1168591744 19:57641840-57641862 CCTTATGTGTGTGGGGAATGTGG + Exonic
1168598896 19:57702197-57702219 CCATATGAGTGCAGTGAATGTGG - Exonic
1168601318 19:57721046-57721068 CCATACGAGTGCAGCGAATGTGG - Exonic
1168616560 19:57842067-57842089 CCTTATATGTGTTGGGAATGTGG + Intronic
1168628881 19:57941402-57941424 CCATATGAGTGCAGTGAATGTGG - Exonic
1168662966 19:58182514-58182536 CCACAAGTGTGATGGGAATGAGG - Intergenic
925076348 2:1019456-1019478 CCATAGGTGTGCTGGGAATGTGG + Intronic
925634440 2:5929153-5929175 CCATGGCTGTGCTGGGGATATGG - Intergenic
928398073 2:30958299-30958321 CCACTGGTTTTCTGGGAATGGGG - Intronic
928658319 2:33475816-33475838 CCTTTGGTGTGCTGGGAACTTGG - Intronic
932463142 2:71896352-71896374 CCAACTCTGTGCTGGGAATGGGG - Intergenic
935495440 2:103775361-103775383 CCATATGTATGCATGGAATGGGG + Intergenic
937658339 2:124402280-124402302 CCAAGGCTGGGCTGGGAATGAGG + Intronic
938573277 2:132582069-132582091 TGACAGGTGTGCTGGGGATGTGG + Intronic
939162620 2:138607896-138607918 CTATAGGGGTGCTGGGCATGTGG + Intergenic
941054977 2:160777091-160777113 ACATATGTGTGCTGGCAAAGTGG - Intergenic
942118472 2:172752151-172752173 CCATGGGTAGGATGGGAATGAGG - Intronic
946624287 2:221594236-221594258 CCACATGTGTGCTGGGATGGGGG + Intergenic
946773940 2:223118011-223118033 CCATGGGTGTGCTTTGAAGGAGG + Intronic
948162209 2:235834232-235834254 ACAGAGGTGTGCTGGCCATGGGG + Intronic
1169756058 20:9044589-9044611 CCATAGATGTTATGTGAATGTGG - Intergenic
1170658735 20:18315824-18315846 CCTTACGTGTGCCGGGAATGTGG + Exonic
1171238462 20:23546621-23546643 CCATAGAAGTGCTGGGAGGGTGG - Intergenic
1171243205 20:23587814-23587836 CCATAGATGTGCTGGGAGGGTGG + Intergenic
1171466187 20:25329374-25329396 CCACAGGGCTGCTGGGACTGAGG + Intronic
1171962712 20:31506415-31506437 CCATGAGTGTTCTGGGAAAGGGG - Intergenic
1172895523 20:38297109-38297131 CCATTGGTGAAATGGGAATGGGG + Intronic
1173014452 20:39212257-39212279 CCATATGTGTGCATGAAATGTGG - Intergenic
1174643428 20:52064986-52065008 CAATAGGTGTGCTGGGGAGGAGG + Intronic
1175492956 20:59391147-59391169 GCAGAGCTGGGCTGGGAATGAGG + Intergenic
1175781342 20:61684216-61684238 CCGTCGGAGTGCTGTGAATGAGG + Intronic
1175782655 20:61693334-61693356 CCAATGCTGTGCTGGAAATGTGG + Intronic
1175809874 20:61852245-61852267 CCAGAGCTGGGCTGGGAATTGGG - Intronic
1176609348 21:8864166-8864188 CCCTAGGTGGGCGGGTAATGAGG + Intergenic
1180027150 21:45172637-45172659 CCATGGGTGTGCTGTGGAGGCGG + Intronic
1180948706 22:19710731-19710753 CCTGACCTGTGCTGGGAATGGGG - Intergenic
1181001543 22:19989997-19990019 GCACTGGGGTGCTGGGAATGGGG + Intronic
1181328632 22:22071400-22071422 AAATAGGTTTGCAGGGAATGAGG + Intergenic
1181566914 22:23744452-23744474 CCCTACGAGTGCAGGGAATGCGG - Exonic
1182067710 22:27442366-27442388 AAGTGGGTGTGCTGGGAATGGGG - Intergenic
1182565186 22:31193234-31193256 TCGTAGGTGGCCTGGGAATGTGG + Intronic
1184653725 22:45930971-45930993 CCGTAGGTGTGCAGGGGGTGGGG - Intronic
950251413 3:11468709-11468731 CCACAGGTGGGCTTGGGATGGGG + Intronic
950940859 3:16889902-16889924 CCACAGGTTTGCTGGGCATGCGG - Intronic
951674908 3:25227612-25227634 ATATAGTTGTGATGGGAATGGGG - Intronic
953643807 3:44734566-44734588 CCCTATGTGTGCAGTGAATGTGG + Exonic
954088790 3:48268430-48268452 TCACAGGTGTGCAGGGAGTGTGG + Exonic
954088858 3:48269018-48269040 CCTTATGTGTGTGGGGAATGTGG + Exonic
954088915 3:48269438-48269460 CCTTATGTGTGTGGGGAATGTGG + Exonic
954533265 3:51338838-51338860 CCGTGGGTGTGCTGGGCAGGAGG - Intronic
960901761 3:122561144-122561166 TCAAAAGGGTGCTGGGAATGAGG - Intronic
960955779 3:123029501-123029523 CCATGGCTCTGCAGGGAATGGGG - Intergenic
961372624 3:126440798-126440820 GCAGAGGTGGGCTGGGAAGGGGG - Intronic
965836980 3:172863573-172863595 CCAAAGGTGTGCTGGAAAACTGG + Intergenic
966304895 3:178520602-178520624 CCATGTGAGTGCTGGGAATTTGG - Intronic
967198715 3:187052086-187052108 CCCTAGGAGTCCTGGGCATGGGG + Intronic
969249849 4:5960019-5960041 CCTGAGATGTGCTGGGCATGAGG - Intronic
969554417 4:7896703-7896725 CCCTGGGTGTGGGGGGAATGAGG - Intronic
973647307 4:52962531-52962553 GCATAGCTGGGCTGGGAATGGGG + Intronic
976611402 4:87034292-87034314 TCGGAAGTGTGCTGGGAATGGGG + Intronic
978522577 4:109631969-109631991 CCAGAGGTGGGCTGTGAAAGGGG - Intronic
979725337 4:123954356-123954378 TCATGGGTGTTCTGGGAAAGGGG + Intergenic
981557468 4:146010425-146010447 CCATTGGTGGGCTGAGACTGGGG - Intergenic
985553595 5:545500-545522 ACATAGGAGTGCTGGGTGTGGGG + Intergenic
986487317 5:8250617-8250639 CTAGAGGTGTGTTGGGTATGAGG + Intergenic
994722132 5:103392587-103392609 CCATTGGGGTGCTGGGAATTTGG + Intergenic
996195971 5:120607513-120607535 CCAGAGTTGTGCTGTGAATATGG + Intronic
996316934 5:122170575-122170597 CCATTGAGGTGCTGGGAGTGTGG - Intronic
996619777 5:125486053-125486075 CCATAGGTTCGCTGAAAATGTGG + Intergenic
998472065 5:142391254-142391276 CCACAGCTGTGCTGGGAATGTGG - Intergenic
998599618 5:143571767-143571789 CCTTAGGTCTTCTGGGAATATGG + Intergenic
998862389 5:146457438-146457460 CCCTGGGTGAGCAGGGAATGGGG + Intronic
998944406 5:147322143-147322165 CCATTGGTGTATTGGGCATGAGG - Intronic
999937228 5:156500750-156500772 CCCTAGGAGTCCTGGGCATGGGG + Intronic
1002901669 6:1415077-1415099 CCATAGCTGTGCTGTGGCTGTGG - Intergenic
1002980568 6:2132338-2132360 CCATAGGTGTTATGGGATGGAGG + Intronic
1005165175 6:22911120-22911142 CCATAAGTGTGCTTGGCATTGGG + Intergenic
1005963929 6:30713098-30713120 CAAGAGGGGTGCAGGGAATGGGG - Exonic
1014055116 6:117005235-117005257 TAATAGGTGTGCTTGGAATAAGG - Intergenic
1018953072 6:168391572-168391594 GGACAGGTGTGCTGGGGATGAGG - Intergenic
1018953091 6:168391653-168391675 GGACAGGTGTGCTGGGGATGGGG - Intergenic
1018953104 6:168391707-168391729 GGACAGGTGTGCTGGGGATGGGG - Intergenic
1018953117 6:168391761-168391783 GGACAGGTGTGCTGGGGATGGGG - Intergenic
1018953206 6:168392086-168392108 GGACAGGTGTGCTGGGGATGAGG - Intergenic
1019261043 7:82185-82207 CCACGGGTGTGCAGGGATTGTGG - Intergenic
1019291852 7:254339-254361 GCATAGGAATGCTGGGACTGGGG + Intronic
1019303443 7:321336-321358 CCACAGGTGTGATGGGAACAGGG - Intergenic
1020251978 7:6476619-6476641 GTATAGGAATGCTGGGAATGAGG - Intronic
1020696812 7:11423104-11423126 ATATAGGTGGACTGGGAATGGGG - Intronic
1022515158 7:30970569-30970591 CCACAGGAGAGCTGGGATTGGGG + Intronic
1023443880 7:40211783-40211805 CCAAAGAAATGCTGGGAATGTGG - Intronic
1024267255 7:47616216-47616238 CCATGGGTGTGCTCAGACTGGGG + Intergenic
1026987982 7:74566888-74566910 CCAGAGGGGTGGTGGGAAAGAGG - Intronic
1033550866 7:142446377-142446399 CCATAGCTGTCCTATGAATGAGG + Intergenic
1037709157 8:21341922-21341944 CCGTAGGGGTGCAGGGGATGAGG + Intergenic
1037764940 8:21766830-21766852 GCATAGGTGTGATGTGCATGAGG - Intronic
1038440159 8:27565834-27565856 CCAGAGCTGTGCAGGGGATGGGG + Intergenic
1039024030 8:33238303-33238325 CAATAGGAGTGATGGGAAGGGGG + Intergenic
1040458486 8:47623464-47623486 CCATCAGTGTGCTGAGACTGAGG + Intronic
1043783045 8:84361326-84361348 CCTTGGCTGTGCTGGAAATGAGG + Intronic
1047454541 8:124997725-124997747 TCATAGGTGTCCTGAGAAGGGGG - Intergenic
1055883547 9:81031938-81031960 CCAAAGGGGTGCTGGGGATGAGG + Intergenic
1057351226 9:94300423-94300445 CCGTATGTGTGCAGGGAATGTGG + Exonic
1059322898 9:113483180-113483202 CCACAGGTGTGCTGGGACCTTGG - Intronic
1059551205 9:115231320-115231342 CCATATGGCTGTTGGGAATGGGG + Intronic
1060034376 9:120242452-120242474 CCACAGGTATCCTGGGGATGTGG - Intergenic
1060050636 9:120375992-120376014 TCCTAGGTGGGCTGGGAGTGGGG - Intergenic
1061132126 9:128714116-128714138 GCAGAGGTGTGGAGGGAATGGGG + Exonic
1061963713 9:134001418-134001440 CCATAGGGGTTCTGGGAGAGCGG + Intergenic
1187533745 X:20118622-20118644 CCAAAGGTGTGCCGGGAGTAGGG + Intergenic
1190485782 X:50923503-50923525 CCATGGGTTTGCTGGGAGGGAGG + Intergenic
1195136494 X:101911993-101912015 CCATATGTGTGCAGGGACTGTGG + Intronic
1195995250 X:110725167-110725189 CCACAGATGTGTTGGGAAAGAGG + Intronic
1196624961 X:117867985-117868007 TCACAGGTCTGCTGGCAATGAGG + Intergenic
1199326474 X:146504253-146504275 CCATAGGTGTGCAATAAATGTGG - Intergenic
1199540999 X:148957859-148957881 CCAAAGGTGTGCTTTGAACGTGG + Intronic