ID: 925076673

View in Genome Browser
Species Human (GRCh38)
Location 2:1022376-1022398
Sequence CTGAGAACGCAGGTCCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925076673 Original CRISPR CTGAGAACGCAGGTCCTCAC GGG (reversed) Intronic
900189383 1:1346830-1346852 AAGAGAAGGCAGGTCCTCGCTGG - Intronic
901312740 1:8282143-8282165 CTGGGAGCTCAGGTCCACACTGG + Intergenic
905627369 1:39497910-39497932 CTGGGACCCCAGGTCCCCACAGG + Intronic
907968948 1:59361775-59361797 TTGAGCACTCACGTCCTCACTGG + Intronic
911167496 1:94737240-94737262 CTGAGAAGGTAGGACATCACAGG - Intergenic
917278490 1:173356232-173356254 CTGAGATCTGAGTTCCTCACTGG - Intergenic
917679897 1:177355070-177355092 CTGAGACCACTGGTCCTCTCTGG - Intergenic
918565725 1:185929241-185929263 CTAAGAACACAGGACCTCAGTGG + Intronic
920296849 1:204963043-204963065 CTGAGGCTGCAGGTCCTCAAGGG + Intronic
920536103 1:206737463-206737485 CTGAGAATGCAGCTCCTTTCGGG + Intergenic
924356782 1:243186367-243186389 CAGAGAACGCTGGGGCTCACAGG - Exonic
1065783162 10:29189547-29189569 CTGGGAACCCAGGTTCTCCCTGG - Intergenic
1067173611 10:43927071-43927093 ATGAGCACGCAGGTTCTCACTGG - Intergenic
1070172081 10:73940658-73940680 CTGAGAGCGCCTGTCCCCACTGG + Intergenic
1070412117 10:76151161-76151183 CTGACAACGAAGATCTTCACAGG - Intronic
1070455080 10:76605154-76605176 CTGAGTCCACATGTCCTCACTGG + Intergenic
1073473101 10:103735990-103736012 CTGAGAGCCCAGGACCTCTCTGG + Intronic
1074768200 10:116716125-116716147 CTGTGAACCCAGGGCCTCAGAGG + Intronic
1075420874 10:122299349-122299371 CTGAGACAGCAGGTACTCAGAGG - Intronic
1076277764 10:129218834-129218856 CTGACAAAGCAGCTCCTCTCTGG - Intergenic
1076751141 10:132543949-132543971 CTGAGAACGCATGTCCGCCTAGG - Intronic
1078432224 11:11297027-11297049 CTTAGAACGATGGTCCTCAGTGG + Intronic
1084732336 11:71081637-71081659 CTGGGAAGGCAGGTACTCAAGGG + Intronic
1085271794 11:75274054-75274076 CTAGGAGGGCAGGTCCTCACAGG + Exonic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088354714 11:108930861-108930883 CTGAGAAGACAGTTCCTCAAAGG - Intronic
1089072510 11:115711328-115711350 CTGGGCACGCAGGCCCTCAGCGG - Intergenic
1091653900 12:2330248-2330270 ACGAGAACGCAGGTCTTCCCCGG - Intronic
1094478553 12:30861611-30861633 ATCAGAAAGCAGGTCCTCACCGG - Intergenic
1100344717 12:93716852-93716874 CTGAAAATGCATGTCCACACAGG - Intronic
1106805227 13:33299598-33299620 CTGAGCACACAGGACCTCAAGGG - Intronic
1115986125 14:39104873-39104895 ATCAGAAAGCAGGTCCTCACCGG - Intronic
1130104439 15:80918863-80918885 CTCAGAACTCAGGTCTTCAGAGG - Intronic
1131851824 15:96551650-96551672 CACAGAGCTCAGGTCCTCACTGG + Intergenic
1131976971 15:97956863-97956885 ATGAAAACACAGGTCCTCATGGG - Intergenic
1136657926 16:31723606-31723628 CAGATCACGCAGGCCCTCACAGG - Intronic
1140231906 16:73124277-73124299 ACCAGAACGCAGGCCCTCACCGG - Intergenic
1140540432 16:75751853-75751875 CTGAGAACCCATGGCGTCACTGG - Intronic
1141636897 16:85318746-85318768 CTGAGAAGCCACATCCTCACTGG - Intergenic
1141691050 16:85596319-85596341 CTGAGAACACTGCTCCTCCCCGG - Intergenic
1142715202 17:1743360-1743382 GTGAGACCTCAGGGCCTCACAGG + Intronic
1151120293 17:71785998-71786020 CTGAGAAAGCAGGCCCTCCATGG + Intergenic
1156455785 18:37293113-37293135 CTGAGGATGCAGGTCCCCAAGGG - Intronic
1156890559 18:42185451-42185473 CTGAGAAGGCTGGTTCTAACAGG - Intergenic
1157964056 18:52188316-52188338 CTGAGGCCCCAGGTCCTCACAGG + Intergenic
1162552889 19:11367657-11367679 ATGAGGAAGCAGGCCCTCACTGG - Intergenic
925076647 2:1022231-1022253 ATGGGAACGCAGGGACTCACAGG - Intronic
925076673 2:1022376-1022398 CTGAGAACGCAGGTCCTCACGGG - Intronic
927518299 2:23684821-23684843 CTGAGATCCCAGGTTCTCAGTGG + Intronic
928411759 2:31059800-31059822 GCCAGAAAGCAGGTCCTCACCGG + Intronic
930846578 2:55912215-55912237 CTGAGATCACAGGTCTTCACTGG + Intronic
935185428 2:100727501-100727523 ATGAGAACACAGGTACACACTGG - Intergenic
938234776 2:129696859-129696881 ATGAGAAAGCGGGCCCTCACCGG + Intergenic
940055615 2:149509852-149509874 CTGAGGATTCAGTTCCTCACTGG + Intergenic
943548678 2:189312122-189312144 CTGAGACCTCAGGTCCTCGATGG + Intergenic
945383827 2:209173436-209173458 CTGAGGCCACAGGTCCTCAGAGG + Intergenic
946180642 2:217947064-217947086 CTGGGAACCCTGGTCCTCAGGGG - Intronic
947689930 2:232125840-232125862 ATGAAAACACAAGTCCTCACAGG - Intronic
947988603 2:234469101-234469123 CTGAGAATGAACGTCCTCTCAGG - Intergenic
1174449106 20:50609006-50609028 CTGGGACCACAGGTCCTCTCTGG + Intronic
1175225115 20:57440082-57440104 CTGAGATCGCAGGTGCTTCCAGG - Intergenic
1175505859 20:59483695-59483717 CTGAGAACCCTGGGCCTCAGGGG - Intergenic
1175722177 20:61294101-61294123 CAGAGAACCCACGTCCTCATGGG + Intronic
1178827073 21:36025873-36025895 CTTAGAACCCTGCTCCTCACAGG - Intergenic
1180082959 21:45494913-45494935 TGGAGACCCCAGGTCCTCACCGG - Exonic
1182824583 22:33253796-33253818 CTGAGAAAGCAGGGCCTGGCTGG + Intronic
1184352181 22:43951761-43951783 CTGAGGACCCAGGTCCTCAGGGG - Intronic
1184851234 22:47122428-47122450 CTGTGCACACAGATCCTCACAGG - Intronic
1184987717 22:48146698-48146720 CAGAGGAAGCAGGTCCTGACAGG + Intergenic
949377265 3:3404726-3404748 CTCTGAACACACGTCCTCACTGG + Intergenic
952354273 3:32570405-32570427 CTGAGGATGCAGGACCTAACGGG + Exonic
953705514 3:45226927-45226949 CCGAGGACACAGGTCCTGACAGG + Intergenic
954301346 3:49702278-49702300 CTGAGAATGCAGGCCCAGACTGG - Intronic
958936066 3:100257131-100257153 CTGGGAATGCAGGTCCTGATGGG + Intergenic
959537309 3:107500932-107500954 CTGAGACAGCAGGTGCTCAGGGG + Intergenic
961329654 3:126131044-126131066 CTGAGGCCGCAGGTCCTTCCTGG - Intronic
962558952 3:136585727-136585749 CTGAGATCAAAGGTCCTCACTGG + Intronic
963745538 3:149120791-149120813 CAGATAACACAGGGCCTCACAGG + Intergenic
964483385 3:157163520-157163542 CTGAGCCCTCAGGTCCTCAATGG + Intergenic
965544722 3:169903841-169903863 CTGAGCCCTCAGGTCCTCAATGG + Intergenic
965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG + Intergenic
971796801 4:31238838-31238860 ATGAGAACGCAGGTCCCAAGAGG - Intergenic
974098510 4:57391427-57391449 CTGAGAACACAGGTTCAAACTGG + Intergenic
975290224 4:72669905-72669927 CTAAGAACTGAGGTCCTTACTGG - Intergenic
976536480 4:86223465-86223487 CTGAGAATGGAGGCTCTCACAGG + Intronic
983516718 4:168665149-168665171 CTGAGATCACAGGCCCACACTGG + Intronic
985840344 5:2300957-2300979 CTCAGAAGGCAGCTCCACACGGG + Intergenic
986177771 5:5366455-5366477 CTGAGAACACAGGGTCTCACTGG + Intergenic
989700878 5:44263333-44263355 CTGAGAAAGCATGTCTTCTCTGG + Intergenic
990614005 5:57488507-57488529 CAGAGAACACAGGTCCTGAAAGG + Intergenic
991103090 5:62815161-62815183 CTGACAAAGCAGATCCTCAGAGG - Intergenic
997508499 5:134437040-134437062 CTGTGACCGCAGGTCCTCTCGGG - Intergenic
1003451820 6:6241589-6241611 CTGAGGACCCAGGTGCTCAATGG - Intronic
1003936652 6:10981711-10981733 CTGAGACCTTAGGGCCTCACTGG + Exonic
1005854855 6:29853005-29853027 CTGAGCAGGCAGCTCCTAACTGG + Intergenic
1006060395 6:31414524-31414546 CTGAGCAGGCAGCTCCTAACTGG - Intronic
1006072838 6:31509296-31509318 CTGAGCAGGCAGCTCCTAACTGG - Intronic
1006293954 6:33161588-33161610 CTGAGAACGCGGCCCCGCACCGG - Intergenic
1006683836 6:35815760-35815782 CCCAGAACTCAGGTCCTCTCTGG + Intronic
1007921287 6:45611962-45611984 CTGAGAATAGAGCTCCTCACTGG + Intronic
1019724076 7:2591309-2591331 CTGGGAAGGCAGGGCCTCACCGG + Intronic
1022232624 7:28428844-28428866 CTGGGATATCAGGTCCTCACAGG + Intronic
1023010071 7:35918232-35918254 CTGAGAGCCCAAGTCCTCAGTGG - Intergenic
1031310622 7:120192698-120192720 ATGAGAAGGCAGGCCCTCCCTGG - Intergenic
1032410315 7:131689585-131689607 CTCAGAACTGAGGTCCTCGCTGG - Intergenic
1032517877 7:132520407-132520429 CTGCGGACCCAGGTCCTCAGAGG - Intronic
1033536239 7:142314361-142314383 AGGAGAACACAGCTCCTCACAGG - Intergenic
1034481069 7:151320821-151320843 CTGGGGATCCAGGTCCTCACTGG - Intergenic
1038981084 8:32760458-32760480 GTGAGACCGCAGGTGCTCACAGG - Intronic
1039471114 8:37814384-37814406 CTGTGAGCGAAGGACCTCACAGG - Intronic
1041416907 8:57620570-57620592 CTGAGAACACAAATTCTCACAGG + Intergenic
1044495899 8:92882081-92882103 GTGACAAGGCAGGTCTTCACTGG - Intergenic
1052804632 9:33001792-33001814 CTGAGAGAGCTGGTCCCCACAGG - Intronic
1053230694 9:36406359-36406381 ATGAGAAGGCAGTTCCTCATTGG + Intronic
1060941619 9:127545965-127545987 CTGGGAACACAGATCCTCGCTGG + Intronic
1061272060 9:129549408-129549430 CTGAGAACTCAGGCCCTGGCAGG - Intergenic
1061942177 9:133889644-133889666 CTGAGGAAGCAGGTGCTGACGGG - Intronic
1186413315 X:9362340-9362362 CTCTGACCACAGGTCCTCACTGG - Intergenic
1187358618 X:18602717-18602739 CTGAGCATGCAGGTTCTCATGGG + Intronic
1187645266 X:21340184-21340206 CTGCGAAAGCAGTGCCTCACAGG - Intergenic
1188180481 X:27049363-27049385 CTGAGAACCCAGGGGGTCACTGG - Intergenic
1189604477 X:42661617-42661639 CTGAGAAAGCAGGCCCTCTGTGG - Intergenic
1190287200 X:48969614-48969636 CTCTGCACGCAGGTCCTCAAGGG - Exonic