ID: 925077794

View in Genome Browser
Species Human (GRCh38)
Location 2:1032971-1032993
Sequence GGGGCAGTCATGTCACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 2, 2: 8, 3: 42, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925077789_925077794 1 Left 925077789 2:1032947-1032969 CCAATCGCGGCAGAATGCAAAGC 0: 1
1: 0
2: 2
3: 32
4: 266
Right 925077794 2:1032971-1032993 GGGGCAGTCATGTCACATGGTGG 0: 1
1: 2
2: 8
3: 42
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925077794 Original CRISPR GGGGCAGTCATGTCACATGG TGG Intronic
900373416 1:2342571-2342593 GGGGCACACAAGACACATGGGGG + Intronic
900689622 1:3972663-3972685 GGGGCTGGCATATCACATGGTGG + Intergenic
900709602 1:4105261-4105283 GGGGCAGGCAGGTCACCGGGTGG + Intergenic
902099211 1:13971876-13971898 GAGGAAGGCATCTCACATGGAGG - Intergenic
902511588 1:16969668-16969690 CAGGCAGTCATCTCACCTGGAGG - Intronic
903385290 1:22922208-22922230 GGAGCACACATGTCACCTGGTGG + Intergenic
903998683 1:27324772-27324794 GAGGGAGGCATCTCACATGGCGG + Intronic
905448122 1:38040683-38040705 AGGGCAGTCCTCCCACATGGAGG + Intergenic
906154092 1:43603915-43603937 TGGTCAGTCCTGTCACATGCAGG - Exonic
907650082 1:56286576-56286598 GTGGCAGTCATGCCACCTGATGG + Intergenic
909478236 1:76106595-76106617 GAAGCAGTCATGTCACTTGGTGG + Intronic
910423759 1:87099354-87099376 GGAACAGGCATATCACATGGTGG + Intronic
912313588 1:108646766-108646788 GGGCGAGGCATCTCACATGGTGG - Intergenic
913052830 1:115131982-115132004 GGAGAAGGCATGTCACATCGTGG + Intergenic
913380195 1:118202228-118202250 GAGGCAGGCATCTCAGATGGTGG + Intergenic
915736972 1:158091242-158091264 GGGGCACACATGGCACATAGGGG + Intronic
915874923 1:159602286-159602308 GGAGCAGGCGTCTCACATGGTGG - Intergenic
916018908 1:160776061-160776083 GGGGCAGTTGTGTCCCATGGGGG - Intergenic
917101109 1:171446225-171446247 GGAGCAGGCATCTCACATGGTGG - Intergenic
917906909 1:179593889-179593911 GGAGCAGTCATGGCACATAGAGG + Intronic
924730854 1:246710369-246710391 GGGGCAGGCATGTCACATGGCGG + Intergenic
1063534729 10:6872339-6872361 GGAAGAGGCATGTCACATGGCGG + Intergenic
1065550777 10:26866737-26866759 GAGGTGGTCATGTCACATAGTGG - Intergenic
1065609976 10:27463306-27463328 GAAGCAGGCATCTCACATGGTGG + Intergenic
1065908752 10:30283096-30283118 GGAGCAGGTATCTCACATGGTGG + Intergenic
1066177703 10:32926561-32926583 GGAGCAGGCTTCTCACATGGTGG - Intronic
1067405420 10:46018831-46018853 TGGGCAGTCAAGCCACTTGGAGG - Intronic
1067561470 10:47307644-47307666 GAGGCATTCAAGCCACATGGAGG + Intronic
1071338575 10:84621970-84621992 GGAGCAGGCATTTCACATGGTGG - Intergenic
1071955259 10:90750986-90751008 GGGGAAATCATGTCAGATGAAGG + Intronic
1072956972 10:99895677-99895699 GGGGCAGGCATGCCACAGGGAGG - Intronic
1073692824 10:105829990-105830012 GGAGCAGGCTTCTCACATGGTGG + Intergenic
1074473686 10:113750369-113750391 GGAGTAGCCATGTCACCTGGTGG + Intergenic
1074817288 10:117152015-117152037 GGGGCAGTCTTGTTAGATGTTGG - Intergenic
1075655282 10:124157009-124157031 GGTACAGTCTTGTCACATGGGGG - Intergenic
1076343531 10:129765717-129765739 GGGGCAGGCAGGTCACCTGCAGG + Intronic
1078346295 11:10552313-10552335 GGGGAAGTCATGTGACAGGAAGG + Intergenic
1079414555 11:20221549-20221571 AGGGTGGTCATGTCAGATGGGGG + Intergenic
1079992564 11:27261885-27261907 GGAGCAGGCACTTCACATGGCGG + Intergenic
1080289349 11:30653470-30653492 GGAACAGGCATCTCACATGGTGG + Intergenic
1083597241 11:63923866-63923888 GGGGCAGGCTGGGCACATGGTGG - Intergenic
1086568618 11:88256933-88256955 GGGGCAGGCATATCACACTGTGG + Intergenic
1087059673 11:93965305-93965327 GGAGCCAGCATGTCACATGGAGG + Intergenic
1087302847 11:96456069-96456091 GGAGCAGGCATCTTACATGGCGG - Intronic
1089469382 11:118708578-118708600 AGGGCTGGCATGTCTCATGGAGG - Intergenic
1089560895 11:119342580-119342602 GGGGCAGGCTTCTCACCTGGGGG + Exonic
1090533196 11:127612689-127612711 GAGGCAGGCATCTCACCTGGAGG + Intergenic
1091713570 12:2760240-2760262 GGGGCAGTTTTGTCTCAGGGAGG - Intergenic
1094418576 12:30244855-30244877 GATGTAGTCAGGTCACATGGTGG + Intergenic
1094602661 12:31923423-31923445 CAGGAAGTCATGTCCCATGGAGG - Intergenic
1098134758 12:67390343-67390365 GAAGCCGGCATGTCACATGGTGG + Intergenic
1099122623 12:78710761-78710783 GGAGCAGGCGTCTCACATGGTGG - Intergenic
1102592128 12:113964725-113964747 GGGGCAGGCAGGTCAAAAGGAGG + Intronic
1102776035 12:115519819-115519841 GAGGCAGTCATGACACCTTGGGG + Intergenic
1105922846 13:24981942-24981964 GGGGCATCCAGGTCACATGAAGG - Intergenic
1106332303 13:28750396-28750418 GAGGAAATCATGTCTCATGGTGG - Intergenic
1106881582 13:34137738-34137760 GGGGCAGTTATGCCACTTGAGGG - Intergenic
1107629123 13:42325502-42325524 GGAGCAGGCACATCACATGGTGG + Intergenic
1107702450 13:43061611-43061633 GGAGCAGGCATTTCAAATGGCGG + Intronic
1107872740 13:44762107-44762129 GGAGCAGACGTTTCACATGGCGG + Intergenic
1110242422 13:73283827-73283849 GGAGCAGGCACATCACATGGGGG + Intergenic
1112180901 13:97079209-97079231 GGAGCAGGCATCTTACATGGTGG + Intergenic
1115048824 14:29030571-29030593 GGGCCAGTCATATCACAAAGAGG + Intergenic
1118051141 14:62029378-62029400 GGGGCAGCCATGTTTCATGCTGG + Intronic
1118141949 14:63093479-63093501 GGGGCAGTCCTGTGAAATGGAGG + Intronic
1118770981 14:68942537-68942559 GGAGCAGTCTTGGCACTTGGAGG + Intronic
1118991766 14:70803105-70803127 GGAGCAGGCATGTCACGTGGTGG - Intronic
1120863863 14:89278602-89278624 GGTGCAGTTTGGTCACATGGGGG - Intronic
1120959510 14:90111689-90111711 GGGGCAGTGTTGTCACAGAGAGG - Intronic
1121465004 14:94110126-94110148 GGGGCAGTCATTCCAGGTGGAGG - Intronic
1123142551 14:106095057-106095079 GGGGCACTCACGACACAAGGGGG - Intergenic
1125277517 15:38008857-38008879 TGTGCAGGCATGTCACATTGAGG + Intergenic
1125745382 15:41994055-41994077 GGGGCAGCCATTTAGCATGGAGG + Intronic
1127469854 15:59281194-59281216 AGGGCAGACATATCGCATGGAGG - Intronic
1127690060 15:61386592-61386614 GGGGTTGGCATGTGACATGGGGG + Intergenic
1127910906 15:63415407-63415429 GTAGCAGGCATCTCACATGGTGG - Intergenic
1128765433 15:70248326-70248348 GGGGCTGCAGTGTCACATGGTGG + Intergenic
1129322964 15:74784744-74784766 GGGGCAGCCATGTCACACTGTGG - Intronic
1129515327 15:76153724-76153746 GAGGCAGGAATGTCACATCGTGG + Intronic
1132631042 16:917652-917674 GGGGCAGGCATGTCTCTTAGGGG - Intronic
1133982218 16:10641517-10641539 TGGGCAGTAATATCACATAGAGG + Intronic
1134064102 16:11215930-11215952 GGGGCAGGCATGTCACATGGCGG - Intergenic
1134090300 16:11388017-11388039 GGGGATGTCAGCTCACATGGGGG + Intronic
1134093833 16:11405855-11405877 GGGTCAGTCAGGCCACAGGGAGG - Intronic
1136692059 16:32039511-32039533 GGGGCACTCAGGACACTTGGTGG + Intergenic
1136792602 16:32982949-32982971 GGGGCACTCAGGACACTTGGTGG + Intergenic
1136877254 16:33871105-33871127 GGGGCACTCAGGACACTTGGTGG - Intergenic
1138146251 16:54614835-54614857 GGAGCAGGCAAGTCACATGGTGG - Intergenic
1139231292 16:65285011-65285033 GGGGCTGTCATTTCAAATGGAGG + Intergenic
1140098331 16:71894171-71894193 GGGGCAGTCATATGACAAGTAGG - Intronic
1140194517 16:72845517-72845539 GGGGCAGTGATGTGAGTTGGGGG - Intronic
1141678680 16:85531303-85531325 GGGGCAGAGAGGTCAGATGGTGG + Intergenic
1141845292 16:86604254-86604276 GGAGGAGGCGTGTCACATGGTGG - Intergenic
1142435736 16:90055853-90055875 GAGGGAGACATCTCACATGGTGG - Intergenic
1203094817 16_KI270728v1_random:1244428-1244450 GGGGCACTCAGGACACTTGGTGG + Intergenic
1145051520 17:19665695-19665717 GAGTCAGTCATCTCACATGTGGG - Intronic
1148812985 17:50306593-50306615 GGGCCTGTCATGTCAAATTGAGG - Intergenic
1153160817 18:2203021-2203043 GGAGCAGGCATCTCACATAGTGG + Intergenic
1153913571 18:9725088-9725110 TGGCCAGTCTTGTCATATGGTGG + Intronic
1154408287 18:14117730-14117752 GAGTGAGTCATCTCACATGGTGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156707779 18:39904442-39904464 GGAGCAGGCATCTCACATGGTGG + Intergenic
1157789038 18:50514331-50514353 GGGGAAATCAGGTTACATGGTGG - Intergenic
1158458306 18:57626374-57626396 AGGGAAGTCATCTCAGATGGTGG + Intergenic
1159695765 18:71554182-71554204 GGAGCAGACATCTCACATTGCGG - Intergenic
1161074244 19:2277391-2277413 GGAGCAGGCATCTCACACGGTGG - Intronic
1161081470 19:2312645-2312667 GTGGCAGTCATGTCCCAGGGAGG - Intronic
1164589984 19:29501512-29501534 GGTGCCAGCATGTCACATGGTGG + Intergenic
1164867168 19:31614180-31614202 GTCACAGTCATGTCAGATGGTGG + Intergenic
1164882094 19:31741208-31741230 GGGGCTGTGATGTCCCAGGGAGG - Intergenic
1164939333 19:32240002-32240024 GGGGCAGGCACCTCTCATGGTGG - Intergenic
1166843117 19:45711166-45711188 GGGGCTGTCAGGTCACAGGTGGG - Exonic
1167509752 19:49889798-49889820 GGGGCACGCATCTGACATGGAGG - Exonic
1167921926 19:52789076-52789098 GGGGCTGTCATGTCAAATGGGGG + Intronic
1167932162 19:52874730-52874752 GGGGCTGTCATGTCATATGGGGG + Intronic
1167945084 19:52981637-52981659 GGAGCTGCCATGTCAAATGGGGG + Intergenic
925040950 2:732350-732372 GGGGGAGTCACGGCACAGGGGGG + Intergenic
925041163 2:732901-732923 GGGGGAGTCACGGCACAGGGGGG + Intergenic
925077794 2:1032971-1032993 GGGGCAGTCATGTCACATGGTGG + Intronic
925673283 2:6334279-6334301 GGGGCAGGAATGTCACATACAGG + Intergenic
926541864 2:14190595-14190617 GGGGCAGTAAAGTCACAGTGAGG + Intergenic
926584006 2:14665299-14665321 GGGGCACTCTTATCACATCGTGG + Intergenic
927107958 2:19844065-19844087 GGAGCACTCAATTCACATGGAGG + Intergenic
928489018 2:31761928-31761950 GGAGCAGTCGTCTTACATGGTGG - Intergenic
928791172 2:34955951-34955973 GGAGCAGACAGGTCACATGTTGG + Intergenic
931289782 2:60862289-60862311 GGAGCAGGCACGTCACATGGAGG + Intergenic
931751432 2:65334040-65334062 TGGGCAGTCAGTTCTCATGGTGG - Intronic
932472257 2:71967671-71967693 GGAGCAGGCACATCACATGGAGG - Intergenic
935564907 2:104595793-104595815 GGGGCTGGCACATCACATGGTGG - Intergenic
936651687 2:114434670-114434692 GGGGCAATGAGGTCAAATGGTGG - Intergenic
940363977 2:152825612-152825634 GAAGCAGGCATCTCACATGGCGG + Intergenic
940970827 2:159894736-159894758 GGGGCAGTCATGTGACCGGCGGG + Intronic
941227433 2:162866613-162866635 GGGGCTTTCATGTCACAGGTAGG + Intergenic
943850909 2:192721559-192721581 GCGGCAGGCATGTCACATGGTGG - Intergenic
944300808 2:198123017-198123039 GGGGCAGTCTTGTCAGACTGTGG - Intronic
944331284 2:198469352-198469374 GGAGCAGGCACATCACATGGTGG + Intronic
944812196 2:203338510-203338532 GGAGCCAGCATGTCACATGGTGG - Intronic
948247808 2:236501125-236501147 GGAGCAGGCATCTCACATGGCGG + Intronic
948771395 2:240252948-240252970 GGGGCCTTCCTGTCACAGGGTGG + Intergenic
948818584 2:240526637-240526659 GGTGCAGACATGCCACCTGGAGG + Intronic
948842530 2:240661212-240661234 GGAGCAGGCATCTCACATGGCGG + Intergenic
948842534 2:240661234-240661256 GGAGCAGGCATCTCACATGGCGG + Intergenic
948878001 2:240840504-240840526 GGGGCAGTCGTGACCCATGGAGG + Intergenic
1169376970 20:5073988-5074010 GGAGCAGGCATGTCACATGGTGG + Intronic
1171185678 20:23122557-23122579 GGGGCTGTCATGTCACCGTGTGG + Intergenic
1175226577 20:57448008-57448030 GGGGCAGTCATGACAGGTGCGGG + Intergenic
1175754320 20:61519884-61519906 GAGGCAGTCATGTCTCAGGTGGG - Intronic
1177517468 21:22174426-22174448 GGAGCAGGCATGATACATGGTGG - Intergenic
1178505791 21:33161974-33161996 GGAGCAGGCATCTCACATGGTGG - Intergenic
1178753660 21:35327427-35327449 GGGGAGGTCATGGCACTTGGAGG - Intronic
1181975637 22:26727398-26727420 GGAGCAGGCATGTCACAAGATGG + Intergenic
1183522094 22:38301317-38301339 GGGGCAGGCAGGGAACATGGGGG + Intronic
1184982881 22:48106766-48106788 GGAGCAGGCATGTCACATGGAGG + Intergenic
950129706 3:10533776-10533798 GGCCCCATCATGTCACATGGTGG - Intronic
950445550 3:13035452-13035474 GGGGCAATCATTTCAGCTGGGGG - Intronic
952256807 3:31702654-31702676 GGGGCAGACAAGTCCCCTGGGGG + Intronic
952274438 3:31864029-31864051 GGCACTGTCATGACACATGGGGG - Intronic
953771073 3:45779110-45779132 GGGACAGGCATGTCCCATGAAGG + Intronic
955941259 3:64149079-64149101 GGCGCAGGCCTGTCACAGGGAGG - Intronic
956170786 3:66431878-66431900 GGGACAGTCATGTGAATTGGTGG - Intronic
956322028 3:68007917-68007939 GGGGCAGGCATGTCAGAGCGCGG + Intronic
956704927 3:71991508-71991530 GGAGCAGGTGTGTCACATGGTGG + Intergenic
957833902 3:85560529-85560551 GAGGCAGACATTCCACATGGAGG + Intronic
958770091 3:98415429-98415451 GGAGCAGGCATCTCTCATGGTGG - Intergenic
960669766 3:120144899-120144921 GGGGGAGTCATGTGACCTGGGGG - Intergenic
962941934 3:140133133-140133155 GGTGTAGACATGTCACATGGTGG + Intronic
962966351 3:140358011-140358033 AGGCTACTCATGTCACATGGGGG + Intronic
963329930 3:143903002-143903024 TGAGCAGGCATCTCACATGGTGG + Intergenic
964323207 3:155519309-155519331 AGAGCAGTCATTTCATATGGTGG + Intronic
965508805 3:169545689-169545711 GTGGCACTCATGTCAGATGCAGG - Intronic
971871023 4:32238581-32238603 GGAGCAGGCGTCTCACATGGTGG + Intergenic
972289464 4:37678125-37678147 GGAGCAGGCACATCACATGGCGG + Intronic
973131399 4:46653069-46653091 GGAGCAGGCATTTAACATGGTGG + Intergenic
974087140 4:57273429-57273451 GATGCATTCATGTCACATGTTGG + Intergenic
975915479 4:79320521-79320543 GAGGAAATCATGTCACAGGGAGG - Intronic
977499384 4:97820743-97820765 AGAGCAGGCATATCACATGGTGG + Intronic
978560550 4:110029307-110029329 GGAGCAGGCGTCTCACATGGAGG - Intergenic
981483220 4:145259083-145259105 GGAGCAGGCATGTCACATGGTGG + Intergenic
982178978 4:152732540-152732562 GGGTGAGGCATCTCACATGGTGG - Intronic
982207810 4:153010348-153010370 GGAACAGGCATGTCACATGGTGG + Intergenic
985710839 5:1428738-1428760 ACGGCATTCATGGCACATGGAGG + Intronic
986190659 5:5493913-5493935 GGGGCATCCATGTCACCGGGAGG - Intergenic
986742307 5:10714844-10714866 GGAGCAGGCGTCTCACATGGTGG - Intronic
988633925 5:32960955-32960977 GTAGCAGCCAGGTCACATGGTGG + Intergenic
988647425 5:33109440-33109462 GGAACAGTCATCTTACATGGTGG - Intergenic
988884075 5:35535950-35535972 GGAGAAGACATATCACATGGTGG + Intergenic
989126294 5:38055291-38055313 GGGGAAGACCTGTCACATGAGGG + Intergenic
990761213 5:59131667-59131689 AGGGCAGTCATCTCCCATGGGGG - Intronic
990889984 5:60637372-60637394 GGAGCAGGCATCTTACATGGCGG - Intronic
991085654 5:62646470-62646492 AGAGCAGGCATGTCACATGGTGG + Intergenic
992153236 5:73927031-73927053 TGGGAATTCATGTCACCTGGTGG + Intronic
994975477 5:106799026-106799048 GGGGAAGTCATATGAAATGGTGG - Intergenic
997111150 5:131076043-131076065 GGAGCTGGCATGTCACATGGTGG + Intergenic
997785148 5:136703867-136703889 GGTGCAGTTATGTCAAATGAAGG - Intergenic
999383421 5:151137710-151137732 GGAGCAGGCATCTCACATGGTGG - Intronic
999413934 5:151378674-151378696 GTGGCAGTAATGGCAGATGGTGG - Intergenic
999971579 5:156869119-156869141 GGAGCAGGCATCTCACATGGTGG - Intergenic
1004004457 6:11626394-11626416 GAAGCAGGCATCTCACATGGCGG + Intergenic
1005113542 6:22312771-22312793 GGAACAGGCATTTCACATGGTGG + Intergenic
1005984890 6:30865321-30865343 GGAGCAGGGATCTCACATGGCGG + Intergenic
1007999956 6:46349988-46350010 GGGCCAGTGATGTCAAGTGGGGG - Intronic
1008274435 6:49526676-49526698 GGTGTAGCCATGGCACATGGTGG - Exonic
1008568604 6:52793283-52793305 GGGGCAGACAGAACACATGGAGG - Intronic
1008573056 6:52833285-52833307 GGGGCAGACAGAACACATGGAGG - Intronic
1009617939 6:66034647-66034669 GGTGCAGGCATCTCACATAGTGG - Intergenic
1014136578 6:117896507-117896529 AGAGCAGGTATGTCACATGGAGG - Intergenic
1014878699 6:126694616-126694638 GGAGCAGGCATCTCACATGGCGG + Intergenic
1015059747 6:128948796-128948818 GGAGCACACATGTCACATGGAGG - Intronic
1015947523 6:138518009-138518031 GAGGAAGTCAGGTCAGATGGTGG + Intronic
1017371177 6:153710962-153710984 AGAGCAGTCATCTCACATGGTGG + Intergenic
1018211979 6:161490919-161490941 GGAGCAGGCATCTCATATGGCGG - Intronic
1018849841 6:167578950-167578972 GGAGCAGGCGGGTCACATGGTGG + Intergenic
1019141250 6:169945298-169945320 GGGGCAGGTGTGTCACGTGGTGG + Intergenic
1019431104 7:1000269-1000291 GGGGCAGGCACGTCTCCTGGGGG - Intronic
1019431154 7:1000434-1000456 GGGGCAGGCACGTCTCCTGGGGG - Intronic
1023714847 7:43033525-43033547 GGAGCAGACATCTCACATGGTGG + Intergenic
1024218279 7:47266409-47266431 GGGGCAGTCCTGCCCCCTGGTGG - Intergenic
1026269621 7:68824875-68824897 GGAGCAGGCATATCACATGGTGG - Intergenic
1026638288 7:72103392-72103414 GGAGCAGTCATGGCATATGAAGG + Intronic
1028435939 7:90803651-90803673 GTGGCAGTTGTGTGACATGGTGG + Intronic
1028570048 7:92277064-92277086 GGAGCAGACACTTCACATGGTGG - Intronic
1028925074 7:96348810-96348832 GGAGCAGGCACATCACATGGGGG - Intergenic
1029910463 7:104140749-104140771 GGGTAAGTCATCCCACATGGTGG - Intronic
1030882647 7:114900530-114900552 GGAGCAGGTATATCACATGGAGG + Intergenic
1032574515 7:133038768-133038790 GTGGCAGTGATGCCACATGTAGG - Intronic
1033344706 7:140518086-140518108 GGGACAGTGATGCCACCTGGTGG - Intergenic
1034116387 7:148587331-148587353 GGGGCAGTCTAATCCCATGGAGG + Intergenic
1034318587 7:150158132-150158154 GGTGAAGTGATGTCACATTGCGG - Intergenic
1035891098 8:3344178-3344200 TGGGGAGACAGGTCACATGGTGG + Intronic
1036692611 8:10953366-10953388 GGAGCAGGCATCTCAGATGGTGG - Intronic
1036957841 8:13209754-13209776 GGAGCAGGCATCTCACATGGTGG - Intronic
1037121842 8:15298174-15298196 GAGGAAGGCATCTCACATGGAGG + Intergenic
1039506980 8:38059331-38059353 GGAGCAGGCATGTCACATGGAGG - Intronic
1040938213 8:52803525-52803547 GGAGCTTACATGTCACATGGCGG + Intergenic
1041429085 8:57758936-57758958 GGGGCAGTAATGATACAAGGTGG - Intergenic
1042882204 8:73505966-73505988 GGAGCAGGCGTGTCACATGGCGG - Intronic
1043254132 8:78111467-78111489 GGAGCAGGTATCTCACATGGTGG - Intergenic
1043512925 8:80967240-80967262 GGGGCAGCCAGGTCAGATGGTGG + Intergenic
1043639628 8:82435525-82435547 GGAGCTGGCATGTCACATGGAGG - Intergenic
1044846808 8:96389863-96389885 TGGGAAGTCATATCAGATGGTGG - Intergenic
1045466338 8:102473768-102473790 GGAGCAGACATATCACATGGTGG - Intergenic
1046203878 8:110963310-110963332 GGAGCAGCCATCTCACCTGGTGG - Intergenic
1047486452 8:125335188-125335210 GGGGCTGTAATGACACATGATGG + Intronic
1049006221 8:139857315-139857337 GGGGAAGGCCTGTCCCATGGAGG + Intronic
1049769259 8:144372284-144372306 GGGGCAGCCATGTCGGTTGGTGG + Intergenic
1053470239 9:38341101-38341123 GGAGCAGCCATATCATATGGTGG + Intergenic
1053528485 9:38853865-38853887 TGGGGAGTCCTGCCACATGGTGG + Intergenic
1054200712 9:62078298-62078320 TGGGGAGTCCTGCCACATGGTGG + Intergenic
1054637647 9:67510065-67510087 TGGGGAGTCCTGCCACATGGTGG - Intergenic
1054985093 9:71252730-71252752 GGAGCAGTCATGGCACATTGCGG + Intronic
1059065003 9:111074496-111074518 GGAACAGGCATCTCACATGGCGG + Intergenic
1059998173 9:119933958-119933980 GGAGCAGGCATGTCACATGGTGG + Intergenic
1060325797 9:122614289-122614311 TGGGGAGTCATGTCATATAGTGG + Intergenic
1062195690 9:135272690-135272712 AGGGCAGGCATGCCAGATGGTGG - Intergenic
1186306184 X:8261141-8261163 TGTGCAGGCTTGTCACATGGTGG - Intergenic
1186458457 X:9729328-9729350 TGGGCTGGGATGTCACATGGTGG + Intronic
1187469006 X:19551856-19551878 GGGGTGTTCATGTCAGATGGTGG - Intronic
1193498701 X:82244759-82244781 GGAGCAGTCATCGCATATGGTGG + Intergenic
1193518848 X:82504115-82504137 GGAGCAGGCATGTCACATTGTGG - Intergenic
1195039237 X:100999096-100999118 GGGACATTCATGATACATGGAGG - Intergenic
1195653876 X:107315619-107315641 GGAGCAGGCATTTCACATGAAGG - Intergenic
1197504723 X:127287644-127287666 GAGGCAGTCATATCTCATTGAGG - Intergenic
1199608315 X:149593851-149593873 GGGCCAGCCATGTCATCTGGCGG - Intronic
1199630805 X:149775509-149775531 GGGCCAGCCATGTCATCTGGCGG + Intronic
1199641745 X:149868881-149868903 GGGCCAGTCATTTTACATGCAGG + Intergenic
1200380388 X:155831083-155831105 GGAGCAGGCAAGTCACATGGTGG + Intergenic
1201254282 Y:12091708-12091730 GGAGCAGTTGTCTCACATGGTGG - Intergenic