ID: 925080603

View in Genome Browser
Species Human (GRCh38)
Location 2:1061160-1061182
Sequence GCGTCCAACCCAGGATCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080603_925080608 9 Left 925080603 2:1061160-1061182 CCGCGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 2
4: 52
Right 925080608 2:1061192-1061214 AAGAATGACAAAAGGTGAACAGG 0: 1
1: 0
2: 3
3: 42
4: 516
925080603_925080607 1 Left 925080603 2:1061160-1061182 CCGCGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 2
4: 52
Right 925080607 2:1061184-1061206 GGAGTGGAAAGAATGACAAAAGG 0: 1
1: 0
2: 4
3: 47
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080603 Original CRISPR GCGTCCAACCCAGGATCACG CGG (reversed) Intronic
900955006 1:5881295-5881317 CCGTCCAACCCAGGTTCTCCTGG + Intronic
907749862 1:57252700-57252722 GCACCCAACCCAGGAAAACGGGG + Intronic
917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG + Intergenic
924458147 1:244234522-244234544 GTGACCCACCCAGGATCAGGTGG - Intergenic
1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG + Intergenic
1075587084 10:123666074-123666096 GCCTGCAACCCAGGATCCCGGGG + Intergenic
1077729836 11:4718660-4718682 GCTTCCAGCCCAGGAACACCAGG - Intronic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1081727089 11:45337882-45337904 ACGTGCAACCCAAGATCAAGTGG - Intergenic
1084195314 11:67521196-67521218 GGGTCCAGGCCAGGATCAGGGGG - Intronic
1092737731 12:11599122-11599144 GTGTCCAACTCAGGGTCAAGTGG - Intergenic
1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG + Intergenic
1104465091 12:128983790-128983812 GCCTCCATCTCAGGGTCACGCGG - Exonic
1107436466 13:40384764-40384786 GAGGCCAAGGCAGGATCACGAGG - Intergenic
1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG + Intergenic
1116866318 14:50034597-50034619 GTGTCCAACACAGGATCGCATGG + Intergenic
1117277744 14:54206692-54206714 CAGTCCAACCCAAGATCAAGGGG + Intergenic
1119676491 14:76559554-76559576 GGGTCCAATCCAGGATAACCTGG - Intergenic
1119873527 14:78036963-78036985 GAGGCCAAGGCAGGATCACGAGG - Intergenic
1122088779 14:99324390-99324412 TCGTCCAACACAGAATCACCAGG - Intergenic
1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG + Intergenic
1134264379 16:12680809-12680831 GGGTTCAGCCCAGGAGCACGTGG - Intronic
1147059071 17:37859653-37859675 GCTGCCAACCCAGGACCAAGGGG + Intergenic
1149457212 17:56797568-56797590 GCGTCCATACCAGGATGATGAGG + Intronic
1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925148109 2:1594544-1594566 GCTTCCAGCCCAGGAGCACTGGG - Intergenic
1170728936 20:18955560-18955582 GACTCCACCGCAGGATCACGGGG + Intergenic
1174393964 20:50234549-50234571 GCGTCCACCCCACCACCACGGGG - Intergenic
1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG + Intergenic
1176230086 20:64028116-64028138 GCGTCCAGCTCAGGGTGACGGGG + Intronic
1182007809 22:26975670-26975692 GCCTCCAACCCAGGAACCTGGGG + Intergenic
1184786256 22:46673403-46673425 GCATCCCAGCCAGGACCACGGGG + Intronic
1185155711 22:49192267-49192289 GCGGCCAACCCAGGTGCAAGGGG + Intergenic
950145345 3:10645958-10645980 GGGTCCCACCCAGGATCAAGTGG - Intronic
950551445 3:13668656-13668678 GCCCCCAACCCAGGATAATGGGG + Intergenic
956779282 3:72591545-72591567 GGGTCCAACCCAGCAGCATGGGG - Intergenic
977809834 4:101346526-101346548 GCGTCCCACCCAGCCTCACTTGG - Intronic
985014282 4:185617078-185617100 GTGTCCACCCAAGGCTCACGAGG - Intronic
986002304 5:3639799-3639821 GCTGCAAGCCCAGGATCACGGGG - Intergenic
986707895 5:10466431-10466453 GCGTGCAACACAGCATCACTGGG + Intronic
995985894 5:118173154-118173176 GAGGCCAAGGCAGGATCACGAGG - Intergenic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
1003185470 6:3826534-3826556 GCGTCCACCCCTGGCACACGTGG + Intergenic
1007608745 6:43135023-43135045 GCTTCCAACCCAGGCTCTAGGGG + Intronic
1010022042 6:71171423-71171445 GAGTCAAAGCCAGGATGACGTGG - Intergenic
1029104527 7:98164637-98164659 GAGTCCTAACCAGGATCACTGGG + Intronic
1029715449 7:102322965-102322987 GCCTCCCACCCAGGATTACTCGG - Intergenic
1043026939 8:75082099-75082121 GAGTGCATCCCAGGATCACATGG + Intergenic
1048468448 8:134686335-134686357 GCCCCCAACCCAGGATAACCAGG - Intronic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1059331473 9:113538334-113538356 GTGACCAACCCAGGATCAGTGGG - Intronic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG + Intergenic
1199962345 X:152788556-152788578 GCTGCCAACCCAGGACCACCCGG - Intergenic