ID: 925080607

View in Genome Browser
Species Human (GRCh38)
Location 2:1061184-1061206
Sequence GGAGTGGAAAGAATGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080606_925080607 -8 Left 925080606 2:1061169-1061191 CCTGGGTTGGACGCTGGAGTGGA 0: 1
1: 1
2: 0
3: 12
4: 241
Right 925080607 2:1061184-1061206 GGAGTGGAAAGAATGACAAAAGG 0: 1
1: 0
2: 4
3: 47
4: 516
925080603_925080607 1 Left 925080603 2:1061160-1061182 CCGCGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 2
4: 52
Right 925080607 2:1061184-1061206 GGAGTGGAAAGAATGACAAAAGG 0: 1
1: 0
2: 4
3: 47
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080607 Original CRISPR GGAGTGGAAAGAATGACAAA AGG Intronic
900436042 1:2631827-2631849 CGAGTGGCAGGAATGAGAAAGGG - Intronic
900859030 1:5212095-5212117 GGAATGGAAGGAAGGAAAAAAGG + Intergenic
900953537 1:5873168-5873190 GGAGGGGAGAGAAGGACACAAGG + Intronic
901365976 1:8748723-8748745 GGGCTGGGAAGAAAGACAAAAGG - Intronic
902058836 1:13624525-13624547 GTAGTGGTAGGAATCACAAAGGG - Intergenic
902078241 1:13804039-13804061 GGTGTGAATAGAAGGACAAAGGG - Intronic
902205146 1:14863087-14863109 ACAGTGGAAAGAAAGAGAAAGGG - Intronic
902226953 1:15002267-15002289 GGAGGGCACAGAATGTCAAAGGG + Intronic
902847762 1:19125550-19125572 GGAGAGGAAAGAATTCCAGAAGG + Intronic
904413227 1:30337613-30337635 GGGGTGGGGAGAATAACAAACGG - Intergenic
904576776 1:31509931-31509953 AGAGAGGAAAGAAAGAGAAAGGG - Intergenic
904803708 1:33116480-33116502 GAAAGAGAAAGAATGACAAAGGG - Intronic
904946681 1:34204161-34204183 GAAAGGGAAAGAATGACATAGGG - Intronic
905341430 1:37280678-37280700 GGTGGGGAAAGAGTGACAAAGGG - Intergenic
905589551 1:39150802-39150824 GGAGAGGATAAAATCACAAAAGG - Intronic
906112003 1:43330364-43330386 GGAGGGGAATGAATGACTCAGGG - Intergenic
906538852 1:46569429-46569451 GCTGTGGAAGGAAAGACAAAAGG - Intronic
906672050 1:47663294-47663316 GTAGTGGAAATGATGGCAAATGG - Intergenic
906892764 1:49736087-49736109 GGAGAGGAAATAAAGAAAAAAGG + Intronic
907962894 1:59299074-59299096 GGAGTTGAGAGAAGGGCAAATGG + Intronic
908923441 1:69224012-69224034 GGAGTGGAAGGCATCACCAAGGG + Intergenic
909741078 1:79030353-79030375 GGAGAGGAAGGAAGGAAAAAAGG - Intergenic
910414827 1:86986683-86986705 GGAGTGGGAAGCATGAACAAAGG + Intronic
911412665 1:97529796-97529818 GGAAAGGAAAGAAAGAAAAAGGG - Intronic
913095022 1:115508126-115508148 GGTGTGGAAAGAATGTTGAACGG - Intergenic
913968779 1:143398185-143398207 TGAGTGGTAGGAATGACAATGGG - Intergenic
914063158 1:144223784-144223806 TGAGTGGTAGGAATGACAATGGG - Intergenic
914115992 1:144742570-144742592 TGAGTGGTAGGAATGACAATGGG + Intergenic
915045454 1:153010157-153010179 AGAGAGGCAAGAATGACTAAAGG - Intergenic
915924274 1:160004297-160004319 GGAATGGAAAGAAAGAAGAATGG - Intergenic
916291522 1:163171860-163171882 GATGTGGAAACAATCACAAACGG + Intronic
916320162 1:163496494-163496516 GGAGATGAAAGAATGCCACATGG + Intergenic
917651569 1:177082875-177082897 TGAGTGGGTAAAATGACAAATGG - Intronic
917860831 1:179141694-179141716 GGAGTGGGAAGAAAGAAGAAAGG - Intronic
918020920 1:180688768-180688790 GGAGTGGGGAGCATGAGAAAAGG - Intronic
918896496 1:190354721-190354743 GCAGTGGAAACAGTGAGAAATGG - Intronic
918992869 1:191721073-191721095 AGCTTGGAAAGAAGGACAAAAGG + Intergenic
919619025 1:199843925-199843947 GACTTGGAAAGAATGACAAAGGG + Intergenic
921354921 1:214276854-214276876 GAAGAGGAAAGATTGACCAAGGG - Intergenic
921976613 1:221209676-221209698 GGAATGGAAATCATAACAAATGG + Intergenic
922090324 1:222389592-222389614 TGGGTGGAAAGAAGGACAGAGGG - Intergenic
922109744 1:222545518-222545540 AGAGTGGACAGAATGAGCAAGGG - Intronic
922545317 1:226452438-226452460 GGCCTGGAGAGAAAGACAAATGG - Intergenic
922676968 1:227559343-227559365 GGAGAGCAAAGAATGAGAGATGG - Intergenic
922818637 1:228469529-228469551 GGATTGCAAAGAAGGAAAAAAGG + Intergenic
923493736 1:234507056-234507078 GGAGTGGAAAGAAGGGCAGCAGG - Intergenic
923740523 1:236650677-236650699 AAAGTGTAAAGATTGACAAAAGG + Intergenic
924043680 1:240008073-240008095 GAGGAGGAAAGAAGGACAAAGGG - Intergenic
924350516 1:243109790-243109812 GGATTGGGAAGAGTGACACAGGG - Intergenic
924427992 1:243971398-243971420 GAAGTTGAAAGACTAACAAAAGG + Intergenic
924596892 1:245454213-245454235 GTTATGGCAAGAATGACAAAAGG - Intronic
1063521831 10:6748321-6748343 AGAGTGGAAAGAATAAGAAAGGG - Intergenic
1063985925 10:11501803-11501825 GGAGAGAAAAGAAGGAGAAAGGG - Intronic
1064057876 10:12113095-12113117 GGAGTGCAAAAAATGACAAAAGG - Intronic
1065832635 10:29629188-29629210 AGAGTGGAAAATAAGACAAACGG + Intronic
1066199053 10:33128152-33128174 GGAGAGGAAAGAAAGGGAAAGGG - Intergenic
1066346639 10:34593000-34593022 GGAATGAAATGAAAGACAAATGG + Intronic
1066774014 10:38870289-38870311 GGAATGGAAAGAAATGCAAATGG + Intergenic
1067820949 10:49529633-49529655 TGAGTGGAAAGTATAATAAAAGG + Intronic
1069133522 10:64735349-64735371 GAAGTAGAAAGAAAGAAAAAAGG + Intergenic
1069372419 10:67762354-67762376 GGAGGGGAAAGCAAGACAATGGG - Intergenic
1069388892 10:67911635-67911657 TGAATGGAAGGAAGGACAAACGG - Intronic
1069813315 10:71178420-71178442 GGAGTGGAAAGACCCACAGACGG + Intergenic
1069950683 10:72016188-72016210 GAAGAGGAAAGAAGGAAAAAAGG + Intergenic
1070638180 10:78145900-78145922 GGTGTGGAAAGAATCATAGATGG + Intergenic
1071075645 10:81748471-81748493 GAATTGGAAAGAAGTACAAAGGG - Intergenic
1071400247 10:85261673-85261695 GGAGTGGAGACACTCACAAAAGG - Intergenic
1072899158 10:99392169-99392191 GGAATGGAAAGAATGTGAGATGG + Exonic
1073380912 10:103077459-103077481 GGAGTGTGAATAATGATAAAAGG - Exonic
1073603552 10:104870656-104870678 GGAGTGGAGGGAAGGAGAAATGG + Intronic
1074002340 10:109386034-109386056 GTACTGGAATTAATGACAAAGGG + Intergenic
1074019322 10:109566505-109566527 GGTGTGGAAAGAAGGAAACATGG - Intergenic
1075513531 10:123091618-123091640 GGACTGGAAAGAGTGACATATGG - Intergenic
1075791616 10:125088315-125088337 GGATTCTAAAGAATGAAAAAGGG + Intronic
1076922064 10:133459380-133459402 GGAGTGCAAGGAAGGACAGAGGG + Intergenic
1077347024 11:2065594-2065616 GGAGTATAAAGAATGGAAAATGG - Intergenic
1077693604 11:4372423-4372445 GAAGAGCAGAGAATGACAAAAGG - Intergenic
1077900666 11:6485243-6485265 GGAGTGGACAGGAAGACCAAGGG - Intronic
1078385283 11:10885672-10885694 GGATTTAAAAAAATGACAAATGG - Intergenic
1079148806 11:17878983-17879005 GGACAGGAAACAATGATAAAAGG - Intronic
1079260409 11:18873197-18873219 GGAGTGGAAAGAAGGAGTCATGG - Intergenic
1080990764 11:37531364-37531386 GGAGGGGAGATAATGATAAAAGG + Intergenic
1081564432 11:44248783-44248805 GAAATTGAAAGAATGACACAAGG - Intergenic
1081632993 11:44701963-44701985 GCAGTGGAAAGAAGGAGAAGAGG - Intergenic
1082706726 11:56501511-56501533 GGAATGAAAAGAAAGACAAAGGG - Intergenic
1082856115 11:57808348-57808370 GGGGTGGAACAAATTACAAATGG - Intronic
1083870489 11:65484925-65484947 GTATTGGAAATACTGACAAACGG + Intergenic
1084869469 11:72088022-72088044 GCAGTGGATGGAATGAGAAAGGG + Intronic
1085312511 11:75525062-75525084 GGAGGGGAAAGAAAGAAAACGGG - Intronic
1085642033 11:78198621-78198643 GGGATGGAAAGAATGGCAGAGGG - Intronic
1085963666 11:81495279-81495301 GGGGTGGAAGGAATTAAAAATGG - Intergenic
1087384855 11:97457943-97457965 GTTGTGGCAAGGATGACAAAAGG - Intergenic
1087698259 11:101406310-101406332 GAACTGGAAAGAATGATGAAGGG - Intergenic
1087842065 11:102930793-102930815 GGGGAGGAAAGAAGGAAAAAAGG + Intergenic
1088111991 11:106272171-106272193 GGAGTGGAAAGAAATGCAAGTGG + Intergenic
1088207876 11:107415126-107415148 GGAGTGGAATAAATGAGAGAGGG - Intronic
1090092810 11:123713960-123713982 GCAGTGGAAATGATGAGAAAAGG - Intergenic
1090440733 11:126723293-126723315 GGAGTAGAATGAAAGGCAAAGGG + Intronic
1090602732 11:128389730-128389752 GGAGTGGGAAGAAGGTGAAAGGG + Intergenic
1091298230 11:134488374-134488396 GAGGTGGAATGAAAGACAAAGGG - Intergenic
1091484544 12:871944-871966 GCAGTGGAAAAAAAGAGAAAAGG - Intronic
1091491520 12:936847-936869 GGAGTGGACAAAGTGACCAAGGG - Intronic
1091748991 12:3010959-3010981 TCAGTGGAGAGAAGGACAAAAGG - Intronic
1091846544 12:3660412-3660434 GGAGAGGAAAGAGTGGGAAAAGG - Intronic
1092569311 12:9705414-9705436 GAAAAGGAAAGATTGACAAATGG - Intergenic
1092661268 12:10740638-10740660 AGAGAGGAAAAAATGATAAAAGG - Intergenic
1092798735 12:12141206-12141228 AGAGTGGAGAGAAAGAAAAAAGG + Intronic
1092959601 12:13583612-13583634 GGAGTGAAAATCATTACAAAAGG + Intronic
1093873002 12:24314692-24314714 GGAGTGAATAGAAGGACATATGG - Intergenic
1093989347 12:25572586-25572608 GGAGGGGAAGGAATGAAAAAGGG + Intronic
1094602054 12:31917684-31917706 GGGGTGGAAAGAATTACAAATGG - Intergenic
1094850504 12:34380311-34380333 GGTGTGGAAGGAAAAACAAATGG - Intergenic
1095392631 12:41727066-41727088 GGATTGTAAAGAAAAACAAAAGG + Intergenic
1095713452 12:45315473-45315495 GGAGTGGCCAGAAAGAGAAATGG - Intronic
1095940699 12:47724958-47724980 GCAGTGGAAGGAGTGACCAAGGG + Intronic
1096040525 12:48511713-48511735 GGAGTCAAAGGAATGAGAAAAGG - Intronic
1096103868 12:48985618-48985640 GGTGTGGAAAGAGTGAGTAAGGG - Intergenic
1097249406 12:57624360-57624382 GAAGTGGAAAGCATGACAGAAGG - Intronic
1097383552 12:58922515-58922537 GGAGAATAAAGAATGAGAAAAGG - Intergenic
1097583490 12:61486918-61486940 GGAGTGGGAAAAATAACTAATGG + Intergenic
1098198726 12:68031850-68031872 GGGGTGGATAGAATGATAAATGG + Intergenic
1098407981 12:70147054-70147076 GGAGGGAGATGAATGACAAAAGG - Intergenic
1098419775 12:70282674-70282696 GCAGAGGAAAGAATGGGAAACGG - Intronic
1098724908 12:73951777-73951799 TGAGTGGAAAAAATGATGAAGGG - Intergenic
1098786353 12:74761680-74761702 GGAAGGTAAAGAAAGACAAAGGG - Intergenic
1098811936 12:75105643-75105665 CGAATGTAAAGAATGAGAAAAGG + Intronic
1100420496 12:94428009-94428031 GGAGAGCAAGGAATGAGAAAAGG + Intronic
1100466912 12:94854397-94854419 TGAGTGGAAAGGTTGAAAAAAGG - Intergenic
1101601846 12:106216343-106216365 GAAAGGAAAAGAATGACAAAAGG + Intergenic
1102525539 12:113510068-113510090 GGAGAGGAAAGAATGACGGTGGG - Intergenic
1104070454 12:125340530-125340552 GTGGTGGAAATTATGACAAAAGG + Intronic
1104542492 12:129680157-129680179 GGAATGGAAATAAGGGCAAAAGG + Intronic
1104567676 12:129899894-129899916 GGAGAGGAAAGAATATCAGAAGG - Intronic
1105806991 13:23958361-23958383 GGAAGGGAAAGGATGACAAAGGG + Intergenic
1106389081 13:29317807-29317829 GGATTGGATAGAATGAAGAAAGG - Intronic
1106469067 13:30038767-30038789 GGAGGGGAAAGGATGAAAAATGG - Intergenic
1106491750 13:30231081-30231103 TGAGTGGACAGGATGCCAAAAGG + Intronic
1107063023 13:36181799-36181821 GGAAGGGAAATAATAACAAATGG - Intronic
1107092747 13:36500081-36500103 GGAGTGGAAGGATTAAAAAAGGG - Intergenic
1107168175 13:37307982-37308004 GGAGAGGAAAGAAGGAGATAAGG - Intergenic
1107626920 13:42296608-42296630 GGAGAGGAAAGATAGAAAAACGG + Intronic
1107634303 13:42376990-42377012 GGAGGGGAAGGAAGGAAAAAAGG - Intergenic
1108900592 13:55402178-55402200 GGAGAGGATAAAATGAGAAATGG - Intergenic
1109349334 13:61157246-61157268 GGACTATAAAGAAAGACAAAGGG + Intergenic
1110420728 13:75304755-75304777 GGAGTGGAAAGAAAGGGAGATGG + Intronic
1111316813 13:86573379-86573401 GGGGTAGAAAGAATGAAAAATGG - Intergenic
1112904098 13:104395896-104395918 GGAGGGGAAAGATAGACAATAGG + Intergenic
1112939880 13:104848398-104848420 GAAATGGAAAGAAGGGCAAAAGG - Intergenic
1113089739 13:106604399-106604421 GGAGGGGAAAGAAGGAAAGAGGG + Intergenic
1115518365 14:34208067-34208089 GGAGAGGAAAAAATGGCATAAGG + Intronic
1116206068 14:41868285-41868307 CTAGTGGAAAGAATGAACAATGG + Intronic
1116217156 14:42031618-42031640 AGAGTGGTAAGAATAAAAAAAGG - Intergenic
1116577770 14:46596757-46596779 GGAATGGCAAGAATGATACAGGG - Intergenic
1117214067 14:53531844-53531866 GGAATGGAGAAAAGGACAAAGGG - Intergenic
1117479547 14:56129265-56129287 GGAGGGAAATGAATTACAAAAGG - Intronic
1117623275 14:57609822-57609844 GGAGGGGCAAGGATGGCAAAAGG - Intronic
1118461399 14:65990451-65990473 GGAGAGGAAAGGAAGAAAAATGG - Intronic
1119696213 14:76715267-76715289 GGGGTGGAAAGAGTGGCTAATGG - Intergenic
1119995966 14:79254033-79254055 GGAATGGAAATAATGAGAGATGG - Intronic
1121668603 14:95691306-95691328 GGAGAGGAAAGACTGACACTGGG + Exonic
1124560632 15:30770583-30770605 GGAGTGTGAAGCAGGACAAAAGG - Intronic
1124812288 15:32953119-32953141 CCAGTGGAGTGAATGACAAAAGG - Intronic
1125987540 15:44069544-44069566 GGAGTGAAAAAAATCCCAAAAGG + Intronic
1126351410 15:47748556-47748578 GAAGAGGGAAGAATGAGAAAGGG + Intronic
1126380351 15:48040153-48040175 GGAGAGAAAAGCAAGACAAATGG + Intergenic
1126914898 15:53455639-53455661 GGAGTTGACAGCAAGACAAAGGG - Intergenic
1127619807 15:60722838-60722860 GGAGAGGGAAGGATGAGAAATGG - Intronic
1127848795 15:62895365-62895387 GGGCTGGGAAGAATGAAAAAGGG + Intergenic
1127869917 15:63063335-63063357 GGAGAAGAGAGAATGACAAATGG + Intronic
1128448738 15:67788312-67788334 TGAGTGGAAGGCAGGACAAAAGG - Intronic
1128599721 15:68985697-68985719 GGAGCAGCAAGAATGAGAAAAGG - Intronic
1128899806 15:71410134-71410156 GGAGGGGAGAGAAAGACAAGGGG + Intronic
1129582485 15:76827159-76827181 GAAATGGAAAGAAAGAGAAATGG - Intronic
1130514470 15:84615628-84615650 GGATTAAAAAGAATGACAGAGGG - Intronic
1131037222 15:89230856-89230878 GGGATGGAAAGAAAGGCAAAAGG + Intergenic
1131315850 15:91336588-91336610 GGAGAGGAAGGAAGGAAAAAAGG - Intergenic
1131744863 15:95436439-95436461 GGGGTTGAAAGAAAGAAAAAGGG - Intergenic
1131967747 15:97862573-97862595 GAGGTAGAAAGGATGACAAAGGG - Intergenic
1132085307 15:98903680-98903702 TGAGTGGATAGAAAGATAAATGG + Intronic
1133614712 16:7465170-7465192 GGTTTGTAAAGAATGTCAAAAGG - Intronic
1133681057 16:8120248-8120270 GGAATGCAAAGGAGGACAAATGG + Intergenic
1133874702 16:9722901-9722923 GGAAAGGAAGGAATGATAAATGG - Intergenic
1134089208 16:11382275-11382297 GAATTGGAAAATATGACAAAGGG - Intronic
1135713811 16:24742995-24743017 GGATTGGAAAGAATCATGAAGGG + Intronic
1137707559 16:50545991-50546013 GGGATGGAAAGAAAGAAAAATGG + Intergenic
1137730346 16:50684895-50684917 GGAGTGGACCGAGTGACAAACGG - Intergenic
1137747902 16:50836699-50836721 GGAGTGGACAGAATGGGCAATGG + Intergenic
1138423158 16:56912955-56912977 GGAATGGAAAGAAAGCCACAGGG + Intronic
1138785279 16:59838405-59838427 TAAGTGAAAAAAATGACAAAGGG + Intergenic
1139188977 16:64839714-64839736 GGATTGGAAACAAAGACCAATGG + Intergenic
1139407615 16:66731467-66731489 GGACTGGAAAGAATTGCAATAGG - Intronic
1139648771 16:68351306-68351328 GGAGTGGAAGGAGTGGCAGAGGG - Intronic
1140322129 16:73963057-73963079 GGTGTGGGAAGGATGATAAAAGG + Intergenic
1140487871 16:75308324-75308346 GTGGTGGAAAGAATGAGACAAGG - Intronic
1140495980 16:75388919-75388941 GGAGTGGAAAAAAAAAAAAAAGG - Intronic
1140720796 16:77770097-77770119 GGAGTAGAGAGAATGTCCAAAGG - Intergenic
1141756259 16:85993081-85993103 AGGGAGGAAAGAAGGACAAAAGG - Intergenic
1141803614 16:86327663-86327685 GGAGTGGAAAGAGTAAAGAACGG - Intergenic
1143347224 17:6258688-6258710 GGAGTGGAAAGTGTAACAGAGGG + Intergenic
1143570208 17:7753405-7753427 GGAGTGGAAGAGATGACCAAGGG + Intronic
1143627470 17:8118768-8118790 GGAGCGGAAAGAATGCCACGCGG - Exonic
1144360013 17:14483310-14483332 GGAGTGGACAGAGAGAGAAAGGG - Intergenic
1144538989 17:16120429-16120451 GGAATGGCAAGAATGAGATAGGG - Intronic
1145077213 17:19866616-19866638 GGAGTGGAAATAATCTTAAAGGG - Intronic
1146124762 17:30222818-30222840 CAAGTGGAAAGAAGAACAAATGG - Exonic
1146824431 17:36010510-36010532 GGAGGGGAAAGAATGAGACTGGG - Intergenic
1147795099 17:43036603-43036625 GGAGTGAAATGAACGACAATGGG - Intergenic
1148354015 17:46962996-46963018 GGCTTGGAAAGAATGCCACATGG + Intronic
1148481923 17:47965507-47965529 GTAGAGGAAAGGATGAGAAAAGG + Intergenic
1148491373 17:48025845-48025867 GGAATGGAAAAAATGACTCAAGG + Intergenic
1148532715 17:48410197-48410219 GGAGTGGAAAGGAGGGGAAAAGG + Intronic
1148979045 17:51555293-51555315 AGAGTGGAAAGAATGTAGAAAGG - Intergenic
1148991088 17:51667999-51668021 AGGGAGGAAAGAATGAAAAATGG - Intronic
1151803068 17:76389011-76389033 GGAGTGGAAAGAATGTGGCAGGG + Intergenic
1151847889 17:76670949-76670971 GTACTGAAAAGAATGAGAAAAGG + Intergenic
1153602237 18:6792160-6792182 GGAAGGGATAGAATTACAAATGG + Intronic
1153930139 18:9871066-9871088 ACAGTGGAAAGAAGGAAAAAAGG - Intergenic
1155028006 18:21959846-21959868 GGAGAGGAAAGAAGGACAGAAGG + Intergenic
1155425090 18:25698641-25698663 GCAGTAGATAGAATGACAGATGG + Intergenic
1155999674 18:32371122-32371144 GGAGAGGACAGCATGACCAAAGG + Intronic
1156217277 18:35012357-35012379 GGAGAGTATAGAATGAGAAAGGG + Intronic
1157094361 18:44673807-44673829 GGAGTGGAAGGAATCAGGAATGG + Intergenic
1157680144 18:49598748-49598770 GCAGTGGGAAGAATTACAAAGGG - Exonic
1158629792 18:59101885-59101907 GGAGAGAAAAGAATCACAAAGGG + Intergenic
1159183044 18:64934338-64934360 GGAGTGGTGAGAATGAAGAAAGG + Intergenic
1159238799 18:65713272-65713294 GGAGGGGAAAGAAAGAAAGAAGG - Intergenic
1159522395 18:69543144-69543166 GGAGTGTAAAGAAAGAAAAAGGG - Intronic
1160052101 18:75443414-75443436 GAGGTGGAAGGAAAGACAAAGGG + Intergenic
1160060589 18:75525853-75525875 GGAGAGGAAGCAATGACACAGGG - Intergenic
1160432938 18:78824723-78824745 GGAGGGGAAAGGATGAGAAGTGG + Intergenic
1160436526 18:78856462-78856484 TTAGTGGAAAGAATGATGAAGGG - Intergenic
1161922423 19:7276497-7276519 GGACTGGAAAGAATGTGGAAAGG - Intronic
1163200507 19:15764562-15764584 AGAGTGGAAAGACGGTCAAAGGG + Intergenic
1163933127 19:20418216-20418238 GGAGTCAGAAAAATGACAAAAGG + Intergenic
1164114461 19:22204839-22204861 TGAGTCAAAAGAATGACAAAAGG + Intergenic
1164492251 19:28726152-28726174 GGAATGGAAGGAAGGAGAAAGGG - Intergenic
1164634504 19:29782344-29782366 GCAGTGGAAAGAAAGACTCACGG - Intergenic
1166043720 19:40217695-40217717 GGGGTGGAAAGAATGACTCAGGG + Intronic
1166908416 19:46132683-46132705 GGAGAGGAAAGAAGAAGAAAGGG + Intergenic
1166908428 19:46132730-46132752 GGAGAGGAAAGAAGAAGAAAGGG + Intergenic
1167239288 19:48333753-48333775 GTAGAGGAAAGAATGACAGGAGG + Intronic
1168161527 19:54513325-54513347 AGAGAGGAAGGAAGGACAAATGG + Intergenic
1202702568 1_KI270712v1_random:175655-175677 TGAGTGGTAGGAATGACAATGGG - Intergenic
925080607 2:1061184-1061206 GGAGTGGAAAGAATGACAAAAGG + Intronic
925529112 2:4839942-4839964 AGAGGGGCAAGAAGGACAAAGGG + Intergenic
927115132 2:19892126-19892148 GCAGTAGGAAGAATGACAGAAGG + Intergenic
928625964 2:33140347-33140369 GGAGTCCAAACAATGACGAATGG - Intronic
928794570 2:35001254-35001276 GGAGGGGAAAGAATGAGAAAGGG - Intergenic
928936402 2:36683413-36683435 GGAATTGAAAGAATGGCTAAGGG + Intergenic
929777823 2:44939449-44939471 GGGGAGGAAGGAATGAAAAAGGG - Intergenic
929778999 2:44945735-44945757 GGAGAGGAGAGAAAGAGAAAGGG - Exonic
930923657 2:56789864-56789886 GGAATGGAAAACATGACCAAAGG + Intergenic
930991087 2:57655416-57655438 TCAGAGGAAAGCATGACAAATGG + Intergenic
932494401 2:72139243-72139265 AGAGTGGAAAGAATAACAGAGGG + Intronic
932576866 2:72967408-72967430 GGAGAGGAAATAATGAGAAATGG + Intronic
932783017 2:74574721-74574743 GGAAGGGAGAGAGTGACAAAAGG - Intronic
933917704 2:87013073-87013095 GGAATGGAAAGAACTACAGAGGG - Exonic
934005292 2:87756844-87756866 GGAATGGAAAGAACTACAGAGGG + Exonic
934153023 2:89167512-89167534 GTAGTAGAAAAAATGAGAAAAGG + Intergenic
934214216 2:90014419-90014441 GTAGTAGAAAAAATGAGAAAAGG - Intergenic
934476320 2:94595952-94595974 GGAGTGTACAGAAAGAGAAAAGG + Intronic
935768249 2:106390930-106390952 GGAATGGAAAGAACTACAGAGGG + Intergenic
936514909 2:113175213-113175235 GGTAGGGACAGAATGACAAAGGG - Intronic
936628784 2:114177645-114177667 GGAATAGAGAGAAAGACAAATGG - Intergenic
936630176 2:114193673-114193695 GGGGTGGCAAGACTGCCAAATGG - Intergenic
936663162 2:114564729-114564751 TGAATGAAAAGAAAGACAAAAGG + Intronic
937088858 2:119191594-119191616 GGACTGGGAAGAATGAAACAAGG - Intergenic
937595763 2:123671162-123671184 GAATTGGAAAGCATTACAAATGG + Intergenic
939296951 2:140278818-140278840 GGAGTGTTAAGAATGAGAACTGG - Intronic
939310333 2:140467858-140467880 GGAGAGAAAGGAATTACAAATGG + Intronic
940561113 2:155298593-155298615 GGAGAGGAAAAAAGGAGAAAGGG + Intergenic
941284325 2:163590710-163590732 ACAGTGAAAAGAATGAGAAAGGG - Intergenic
941442506 2:165555685-165555707 AAAATGGAAACAATGACAAAAGG + Intronic
941512667 2:166432637-166432659 GCAGTGGCAAGAATTAAAAAAGG - Exonic
942020147 2:171859674-171859696 GGAGTGGAAGGAAAGAGAATGGG + Intronic
942316853 2:174705028-174705050 GGAGTGGAAAGAAAGAGATAAGG + Intergenic
942392870 2:175514388-175514410 GGAGTGGAGAGGATGGCAGAAGG + Intergenic
942543371 2:177037695-177037717 GCAGGGGAAAAAATGACAAAGGG + Intergenic
942544527 2:177049277-177049299 GGAGTGGAAAGAGTTAAAGAGGG + Intergenic
942918213 2:181338425-181338447 GGAGAGGAAAGAATCAAGAATGG - Intergenic
944331830 2:198477595-198477617 GGGGTGGAAAGGAAGAAAAAAGG + Intronic
944418531 2:199503715-199503737 GGACTGGAAGGAATGAGAAATGG + Intergenic
945746730 2:213727614-213727636 GGAGAGGAATAAATGAGAAAAGG + Intronic
946282858 2:218679125-218679147 GGAAGGGAAAGAATGACTGATGG + Intronic
947108402 2:226692068-226692090 GAAGTTGAAAGAAAGAAAAAAGG - Intergenic
948555647 2:238808688-238808710 AGAGTGGAAAGAATAAAACATGG - Intergenic
948649342 2:239430298-239430320 TGTGTGGACAGGATGACAAAGGG - Intergenic
1168749742 20:273934-273956 GGAGGGGAAAGAAAGAAAGAAGG + Intronic
1169378924 20:5089729-5089751 GTAGTGGAAAGTATAACAGAGGG + Intronic
1169622097 20:7518766-7518788 GGGCTAGAAAGACTGACAAATGG - Intergenic
1169760890 20:9092711-9092733 GGAGTGGTGAGAAAGACAGAAGG - Intronic
1170551323 20:17479977-17479999 GCAGTAGAAAGAAGGAAAAAAGG - Intronic
1170990239 20:21294675-21294697 GGAGTGGAATGAATTACCAACGG - Intergenic
1172369521 20:34377505-34377527 GGTTTGGAAACAATGACAAATGG + Intronic
1174789386 20:53463480-53463502 GGAGAGGAAAGAAAGAGAGAAGG + Intronic
1177782298 21:25634294-25634316 TGGGTGGAAAGAATTAAAAATGG + Intergenic
1177868962 21:26547196-26547218 GGAGTGGGGAGAAGGTCAAAGGG - Intronic
1177944899 21:27455871-27455893 GGAGAGGAAGGAAAGAAAAAAGG - Intergenic
1178133783 21:29603187-29603209 AGAGTGGATATTATGACAAAAGG + Intronic
1178506902 21:33169891-33169913 GGAGTGGACAGAAAGAGAAATGG + Intronic
1179134573 21:38668346-38668368 GAAGGGGAAAGAATAACACAGGG + Intergenic
1179354458 21:40646078-40646100 GGATTGAAAAGAAAGACACAGGG + Intronic
1179360917 21:40708059-40708081 AGAGAGAAAAAAATGACAAATGG - Intronic
1179365225 21:40752780-40752802 GGGGAGTAAAGAATTACAAAAGG + Intronic
1179434740 21:41352429-41352451 GGAATGGAAGGAAGGAAAAAGGG + Intronic
1181595708 22:23913312-23913334 GGAGGGGAAAGAGGGACAGAGGG - Intergenic
1182016422 22:27043968-27043990 TGAATAGAAAGAAGGACAAAAGG - Intergenic
1182055675 22:27352786-27352808 GAAGGGGAAAGAAGGAAAAAGGG - Intergenic
1182091414 22:27597637-27597659 GGAGTTGAAACAATGACATTGGG + Intergenic
1182915097 22:34022061-34022083 GGAATGGAAAGGATGGGAAAGGG + Intergenic
1184318366 22:43718282-43718304 TGACTGCAAAGAATCACAAATGG + Intronic
1184415334 22:44348867-44348889 GGAGTGGGAGGAAGGACAAAAGG + Intergenic
949501314 3:4682785-4682807 AGAGTCAAATGAATGACAAATGG - Intronic
949952080 3:9237708-9237730 TGACTGGATAGAATGACAAGGGG + Intronic
950660594 3:14464577-14464599 TGAGTAGAAACAATGAGAAAGGG - Intronic
951186645 3:19721536-19721558 AGAGTTGAATCAATGACAAAAGG + Intergenic
952409678 3:33036019-33036041 TGAGAAGAAGGAATGACAAAGGG + Intronic
952655470 3:35780362-35780384 GGAGTGCAAAGAATGAGGAATGG + Intronic
953430827 3:42839056-42839078 GGTGTGGAGAAAATGAGAAAGGG - Intronic
953604852 3:44405370-44405392 GTAGTAGAAACAATGACTAAAGG + Intronic
953634091 3:44647679-44647701 TGAGTGAAAATAATCACAAAAGG + Intronic
953668097 3:44940402-44940424 CAAGTGGAAAGAATGAAGAAAGG - Intronic
953754661 3:45635970-45635992 GCAGTTGAAAGAGTGACAGAGGG + Intronic
954842262 3:53522246-53522268 GGAGTGGACAGAATGCCAGTGGG - Intronic
954958822 3:54546759-54546781 GGAGTGGAGTGAATTATAAATGG + Intronic
956573842 3:70729189-70729211 TGATTGGACAGAATGAGAAATGG - Intergenic
956825603 3:72994972-72994994 GGAGGGGAGAGAAGGACCAAGGG - Intronic
957303439 3:78423859-78423881 GAAGTGGAAACAGTGACCAAAGG + Intergenic
958019341 3:87978851-87978873 GGAGTGGAAAGAAGGATGGAAGG + Intergenic
958500609 3:94902836-94902858 GTATTGTAAAGAATGCCAAAAGG - Intergenic
958906830 3:99951036-99951058 GGTGCAGAAAGAGTGACAAAGGG - Intronic
959755275 3:109889995-109890017 GGAATGGAAAGATGGTCAAAAGG - Intergenic
959799826 3:110479810-110479832 CAACTGGAAAGAATAACAAAGGG + Intergenic
960038908 3:113129480-113129502 GGGGAGGAGAGAAAGACAAAAGG - Intergenic
960159544 3:114335123-114335145 GGAGAGGAAAAAAAGTCAAAGGG - Intergenic
960477595 3:118147784-118147806 GTAGTAGAAAGAATTACAAAAGG - Intergenic
960683365 3:120272577-120272599 AGAGGGGAGAGAAAGACAAAAGG + Intronic
960973386 3:123154816-123154838 AGAGTGGCAAGGTTGACAAAAGG + Intronic
961051357 3:123749829-123749851 GCAATGGAAAGAAAGTCAAATGG - Intronic
961378599 3:126482870-126482892 GGGGTGGCAAGAATGGCAGAGGG - Intronic
964313656 3:155420611-155420633 GGGAGGGAAAGAAAGACAAAGGG - Intronic
964595100 3:158417387-158417409 GGAGAGGAAAGGAAGAAAAAAGG - Intronic
965202749 3:165680976-165680998 GGAGTGGGAAGGCTGAAAAATGG - Intergenic
965635174 3:170773418-170773440 GAAGAGAAAAGAAAGACAAAAGG - Intronic
966247449 3:177824977-177824999 AGAGGGGGAAGGATGACAAAAGG - Intergenic
966468881 3:180264934-180264956 GAAGTGGGAAGAATGTCATAGGG - Intergenic
966836273 3:184051600-184051622 GGAGTGGAAGGAGTGAGAAAGGG - Intergenic
967138451 3:186532489-186532511 GGAGAGGAAAGGATGAAAGAAGG - Intergenic
967906537 3:194505806-194505828 GGATTGAAAAAAAAGACAAATGG + Intergenic
968759736 4:2436616-2436638 GCAGTGCAAGGAATGACACAAGG - Intronic
969120210 4:4903022-4903044 GGGGTGGAGAGGATGAGAAAAGG + Intergenic
969980942 4:11153898-11153920 GCAGTGGAAAGAGGCACAAAGGG - Intergenic
970280839 4:14453008-14453030 GGAGTGGAAAAAATGGCTAACGG - Intergenic
970370421 4:15400428-15400450 GGAGTGGAGAGAAACAGAAAAGG + Intronic
971155396 4:24076086-24076108 GGAGTGGAAAGAAGCAGAGAGGG - Intergenic
971391772 4:26192757-26192779 GGAATGGAAATAATAAGAAATGG - Intronic
971884899 4:32432059-32432081 GGAGGGGAAAAAATAACAATTGG - Intergenic
972393336 4:38634053-38634075 GGAGTGGAAATGAAGAGAAATGG - Intergenic
972621496 4:40751425-40751447 GGAATGGAAAGAAATACACAGGG - Intronic
972672942 4:41231330-41231352 TGGGTGGAAAGAATTACAAAGGG + Intergenic
972831275 4:42816307-42816329 TGAGTGGAAAGAATTACTCAGGG + Intergenic
972845278 4:42982033-42982055 GAAGGAGAAAGAAAGACAAAGGG - Intronic
973165242 4:47069364-47069386 GGACTGAACAGAATGGCAAAAGG - Intronic
973182099 4:47281868-47281890 TGAGTGGGGAGAAAGACAAAGGG + Intronic
973257463 4:48127878-48127900 GGGGTGGAAGGAATGTCAATAGG - Intronic
973680106 4:53308460-53308482 GGAGGAGAAAGAGTGAGAAATGG - Intronic
973970762 4:56211822-56211844 TTAGAGGAAAGCATGACAAATGG + Intronic
974636631 4:64572284-64572306 GAAGATGAAAGAATGAGAAATGG + Intergenic
975875981 4:78837633-78837655 GGGGTGGAAAGAAAGAAAAATGG - Intronic
976320484 4:83708817-83708839 AGAGGGGAAAGAAAGTCAAATGG - Intergenic
976442764 4:85094947-85094969 GGTGTGAAAATAATGACCAAAGG + Intergenic
978315209 4:107427856-107427878 GTAGAGGAAAGAAGGAAAAAAGG + Intergenic
978331520 4:107618434-107618456 TAAGTGGCAAGAATGAGAAAGGG + Intronic
978393237 4:108250031-108250053 GGGGAGGAATGAATTACAAAAGG + Intergenic
979156341 4:117394873-117394895 GCAGTGCAAAGAATGAGAGAAGG + Intergenic
979251424 4:118570767-118570789 GGATTGGGAAGAGTGACACAGGG + Intergenic
980546583 4:134271303-134271325 GGAGGGGAAAGACTGAGGAACGG - Intergenic
980600778 4:135021719-135021741 GGAGTGAAAAGAGTGGCAAGAGG - Intergenic
980770099 4:137360907-137360929 GGAGTGGAAAGGAAGATATAAGG + Intergenic
981032854 4:140143460-140143482 GAGGTGAAAAGAATGACAACTGG + Intronic
981140507 4:141262552-141262574 GAACTGGAAATAATAACAAAAGG + Intergenic
981826667 4:148950166-148950188 CGAATGGAAAGAAAGACAGAGGG - Intergenic
982389393 4:154848110-154848132 AAAGTGGAAAGAAACACAAAAGG + Intergenic
983674670 4:170278787-170278809 GTAGAGGAAAGGATAACAAAGGG - Intergenic
984055943 4:174929458-174929480 GGAGTGAAAAAAATGGAAAAGGG + Intronic
984656970 4:182328856-182328878 GGAGAGGAAAGAAAGAGAAGAGG + Intronic
984812498 4:183807396-183807418 AGAGTGGAAAGCATCCCAAAGGG - Intergenic
985095071 4:186404918-186404940 GGAATGGAGAGAATGCGAAAAGG - Intergenic
986635301 5:9815871-9815893 GGAATGGCAAGAATGAGAAGTGG + Intergenic
987793565 5:22599350-22599372 GGAGTGGAAAATACAACAAAAGG + Intronic
987981978 5:25097371-25097393 TGAGTGGTAAGAAGTACAAATGG + Intergenic
988036706 5:25836337-25836359 GGAGTTTAAAGAATGGAAAAAGG - Intergenic
988977850 5:36533106-36533128 GGAGAGAAATGGATGACAAAGGG + Intergenic
989273439 5:39558710-39558732 TGAGTGGAAAGAATGATGACCGG + Intergenic
989333579 5:40288425-40288447 GGAGTGGAAGGAAGCAGAAATGG + Intergenic
989382397 5:40822286-40822308 GGAAGGGATAGAAAGACAAAAGG + Intergenic
991678262 5:69110644-69110666 GCAGTGGAAAAAATCACAAAGGG + Intronic
992052910 5:72956799-72956821 GGGGTGGAAAGAATGAGGAAGGG - Intronic
992391497 5:76335338-76335360 GGAGTGGAAAGCTGGACAAAGGG - Intronic
992512313 5:77449388-77449410 GGTGTGGACAGCAAGACAAAAGG + Intronic
993000558 5:82376528-82376550 GGAGGGGAAAGAATCACATGTGG + Intronic
993774848 5:91980638-91980660 GGAAAGGAAAGAAAGAGAAAGGG - Intergenic
993859958 5:93124259-93124281 GGGGTGGAAAAAATAATAAATGG - Intergenic
995169472 5:109090793-109090815 GGAGTAAAAAGAAAAACAAATGG + Intronic
996156296 5:120106978-120107000 AGAGAGGAAAGAAAGAAAAAGGG - Intergenic
997608595 5:135194243-135194265 GGAGAGGAAAGAAGGCAAAATGG + Intronic
998630563 5:143893339-143893361 GGATTGGAAACTAGGACAAAGGG - Intergenic
998951518 5:147397292-147397314 GCACTGGACAGAATGACACAGGG + Intronic
999216803 5:149942261-149942283 GAAGAGGAAAAAATGAAAAAAGG - Intronic
999416101 5:151397483-151397505 GAAGTGGTAAGAATGTCAAGTGG + Intergenic
1001135244 5:169097393-169097415 GGAGAGGAAGGAAGGAAAAAAGG + Intronic
1002095408 5:176828061-176828083 GGAGGGGGAAGGAGGACAAAAGG - Intronic
1002585036 5:180239874-180239896 GGATTGGAAGAAATGTCAAAAGG + Intronic
1003567880 6:7235988-7236010 GGAGTGGAAGGAAGGAGGAAAGG - Intronic
1004061498 6:12202602-12202624 GGACTGGAAAAAAAGAGAAAAGG - Intergenic
1004064471 6:12229499-12229521 TGAGTGGAAAGGAAGATAAAGGG - Intergenic
1004571648 6:16851613-16851635 GGAATGAAAAGGATGACAATCGG - Intergenic
1004816755 6:19319348-19319370 AGAGAAGAAAGAATGAAAAAGGG - Intergenic
1005113440 6:22311801-22311823 GGAGAGGAAAGAAAGAAAGAAGG - Intergenic
1005222335 6:23600992-23601014 GGAGTGGAGAGAAAAATAAAAGG + Intergenic
1005766818 6:29019609-29019631 GGAATGTAAAAAGTGACAAAAGG - Intergenic
1007021318 6:38524858-38524880 AGAGAGGAAGGAAGGACAAAAGG - Intronic
1007072553 6:39048219-39048241 GGGGTGGGGAGACTGACAAATGG - Intergenic
1007334767 6:41147413-41147435 GGAATGGGAATGATGACAAAGGG - Intergenic
1007529151 6:42525563-42525585 GAAGTAGGAAGAAGGACAAAGGG + Intergenic
1008499510 6:52166932-52166954 GGAAAGGGTAGAATGACAAAAGG - Intergenic
1008513421 6:52298046-52298068 GAAGGGGAAAGAAGGAGAAAGGG + Intergenic
1008824309 6:55674048-55674070 TGAGAGTAAAGAAGGACAAAAGG + Intergenic
1009517011 6:64633496-64633518 GGAGTGGAAAGAACAAAACAGGG + Intronic
1011305470 6:85921215-85921237 GGACTGGAAAGAAGGATGAATGG - Intergenic
1012671183 6:102050277-102050299 GGAAGGGAAAGAATGATAGAGGG + Intronic
1013329878 6:109089797-109089819 GGAGTGGAAAAAATTAAAATGGG - Intronic
1013838139 6:114357280-114357302 TAAAAGGAAAGAATGACAAATGG - Intergenic
1014215976 6:118753110-118753132 GGGAAGGAAGGAATGACAAAAGG - Intergenic
1014730556 6:125026569-125026591 TGTGTAGAAAGAATGACAAAAGG + Intronic
1014755947 6:125302004-125302026 GGAGGGGGAAGAAAGACAAGGGG - Intronic
1015323322 6:131900394-131900416 GGACTAGAAAGAATGTCAACAGG - Intergenic
1015972086 6:138752430-138752452 GGAATGGTAGGAAAGACAAACGG + Intronic
1016169241 6:140988821-140988843 CATGTGGAAAGATTGACAAATGG + Intergenic
1016359436 6:143251760-143251782 ACAGTGGAAAGAATGGTAAAAGG - Intronic
1017244101 6:152203404-152203426 GGATTGGAGAGTTTGACAAACGG - Intronic
1017285747 6:152674428-152674450 AGAGTGGAAGGAATGAAAGAAGG + Intergenic
1017655828 6:156628509-156628531 GCACTGGAAGGAAAGACAAATGG - Intergenic
1018129090 6:160711101-160711123 GGAATGGAAAGAACTACAGAGGG + Exonic
1018659458 6:166072770-166072792 GAAGTGGAAAGAAAGACGAGAGG - Intergenic
1019871581 7:3768798-3768820 GGAGAGGGTAGAATGAGAAAGGG - Intronic
1020339235 7:7091493-7091515 GCCCTGGAAAGAATGACTAAAGG + Intergenic
1020467036 7:8492203-8492225 CTTCTGGAAAGAATGACAAAAGG - Intronic
1020504715 7:8969983-8970005 ATAGAGGAAAGAATGAGAAAAGG + Intergenic
1021203857 7:17755589-17755611 GGTGTGGTAAGAATTACAAAGGG - Intergenic
1021248994 7:18300351-18300373 GGAGTGGAACCAATTAAAAACGG - Intronic
1022947216 7:35299266-35299288 CGAATGGAAGGAATGACTAAAGG + Intergenic
1022962172 7:35437917-35437939 GGAGAGGAAACAATGATATAAGG + Intergenic
1023156418 7:37256638-37256660 GGAGGGGAGAGGAGGACAAAGGG + Intronic
1023591956 7:41790011-41790033 CAAGTGGAAAGTATGAAAAAGGG - Intergenic
1023724796 7:43131877-43131899 GGAGGAGACAGAAGGACAAAGGG - Intronic
1024066627 7:45742596-45742618 GGAGTGGGATGAATCATAAAAGG - Intergenic
1024367727 7:48541125-48541147 GTAGTGGCAAGATTAACAAAAGG + Intronic
1024780211 7:52839056-52839078 GGAGGGGAAAGAACGGCCAAAGG - Intergenic
1024903168 7:54345806-54345828 AGTGTGGGAGGAATGACAAAGGG - Intergenic
1024938707 7:54739906-54739928 GGAGGAGAAAGGGTGACAAAGGG + Intergenic
1025093956 7:56083619-56083641 GGAGCGGAGAGAAGGGCAAAGGG + Intronic
1025151278 7:56552813-56552835 GGAGTTGAAAGACTTAGAAAGGG + Intergenic
1026157787 7:67842307-67842329 GGAGCAGAAAAAATAACAAATGG + Intergenic
1026870728 7:73849672-73849694 GGAGTGGAAAGAATCACTCTCGG - Intergenic
1027715664 7:81666371-81666393 GGAGTAGAATGAATAATAAATGG + Intergenic
1028221903 7:88207247-88207269 GGAATGGAAAGAAAGACCATGGG - Intronic
1029001684 7:97160769-97160791 TTGGTGGAAGGAATGACAAATGG + Intronic
1030114564 7:106053595-106053617 GGAGGGGAAAAAAGGAAAAAGGG - Intergenic
1030195398 7:106847843-106847865 GTAGTAGAAAGACTGAAAAATGG - Intergenic
1030401072 7:109050620-109050642 AAAGTGGAAAGAATGAACAAAGG - Intergenic
1031160070 7:118155781-118155803 GGAGTTGAAAGTATTTCAAAGGG - Intergenic
1031300048 7:120053978-120054000 GGAATTGGAAGGATGACAAATGG - Intergenic
1032991813 7:137402637-137402659 GAAGTGGAAGGAATAGCAAAGGG - Intronic
1033065880 7:138153460-138153482 GGAGTGAAATGTATGATAAATGG - Intergenic
1033253394 7:139778475-139778497 GGAGTGGAATGAATGAATGAAGG + Intronic
1033573543 7:142657561-142657583 TGGGTGGAAATAATGGCAAAAGG - Intergenic
1033683963 7:143622102-143622124 GAAGTGGAGAGAATGAGACAAGG + Intronic
1033687139 7:143701291-143701313 GAAGTGGAGAGAATGAGACAAGG + Intronic
1033700649 7:143835536-143835558 GAAGTGGAGAGAATGAGACAAGG - Intergenic
1033977482 7:147119758-147119780 GGAGAGGAAAGAAAGAAAGAAGG + Intronic
1034527401 7:151674167-151674189 GGGATGCAAAGAAAGACAAAGGG + Intronic
1034550587 7:151818168-151818190 TGACTTCAAAGAATGACAAATGG + Intronic
1036495251 8:9264479-9264501 AGAGTGATAAGAATGACAATAGG + Intergenic
1036743371 8:11387293-11387315 GGTGTGCAAACAATGACAACAGG - Intergenic
1037276859 8:17189695-17189717 GGATTGGACAGAGTGGCAAAAGG + Intronic
1038346660 8:26738648-26738670 ACAGTGGAAAGAGAGACAAAGGG + Intergenic
1038495481 8:27999245-27999267 GGATGGGAGACAATGACAAATGG - Intergenic
1038497484 8:28013975-28013997 GGAATGGAAAGAAAGGGAAAAGG + Intergenic
1038670262 8:29577404-29577426 GGAGGGGAAAGAAGGCCCAAAGG - Intergenic
1038716656 8:29997311-29997333 GGACAAGAAAGAATGACAGAAGG + Intergenic
1039836237 8:41258550-41258572 GGGGTGGGAAGAAGGAGAAAGGG - Intergenic
1039845904 8:41325261-41325283 GGAGAGGAAAGAGGAACAAAGGG - Intergenic
1040509385 8:48080813-48080835 AGAGGAGAAAGCATGACAAATGG - Intergenic
1040644840 8:49386670-49386692 GGAGGGGAAGGAATGATACAGGG - Intergenic
1040676633 8:49757943-49757965 GGAATGGAAAGGATGATTAAAGG - Intergenic
1040676968 8:49762097-49762119 TTAGTGGAAAGAAAGACAGAAGG - Intergenic
1041191283 8:55357716-55357738 AGAGTGGGGAGAATGACAGATGG + Exonic
1041281820 8:56218163-56218185 GTAATGGGAAGAAAGACAAATGG + Exonic
1042872217 8:73409690-73409712 GGTTAGGAAGGAATGACAAAAGG - Intergenic
1043423959 8:80130196-80130218 GGGGTGGAAAGGATGAAAAAGGG + Intronic
1044381212 8:91535774-91535796 GTAGTGGAAAGAATGAGACAAGG + Intergenic
1044947159 8:97399985-97400007 GGTATGGACAGAAGGACAAAGGG + Intergenic
1044966295 8:97577009-97577031 GCAGTGGAAAGAGAGAAAAATGG + Intergenic
1045627845 8:104077256-104077278 TGATAGGAAAGAAGGACAAAAGG + Intronic
1045693917 8:104786746-104786768 AGAGTGGAAACAAAGGCAAATGG - Intronic
1046707760 8:117475373-117475395 GATGGGGAAGGAATGACAAAAGG + Intergenic
1047317173 8:123745432-123745454 GGAGTGGCAAGAATTGGAAAGGG + Intergenic
1047720802 8:127637444-127637466 GCAGGGGAAAGAAAGAAAAATGG - Intergenic
1048707960 8:137175715-137175737 GAAGTGGAAAAAAGGACACATGG - Intergenic
1049454523 8:142680321-142680343 GAGGTGGAAAGAAGGACAAAGGG + Intronic
1049563809 8:143326975-143326997 GGAGGGGACAGAAGGACAGAAGG + Intronic
1049630657 8:143654154-143654176 GGAGGGGACAGAATCACAAGGGG - Exonic
1049800857 8:144516966-144516988 TGTGTGGAAAAAATGACAAGAGG + Intronic
1049824405 8:144659036-144659058 GGATTGGACAGAAAGACAATGGG - Intergenic
1050175337 9:2864212-2864234 GGATTGGGAAAAATGACTAATGG + Intergenic
1050408889 9:5340407-5340429 GGAGTGGAAGGAAAGTCCAATGG - Intergenic
1050572931 9:6960237-6960259 GCAGTTGAAAGAAGGATAAATGG + Intronic
1050674254 9:8034083-8034105 GGAATGGAAAGAAAGCAAAAAGG + Intergenic
1052027525 9:23590084-23590106 GAAGTGAACAGAATGACCAATGG + Intergenic
1052965476 9:34337481-34337503 GGACTGGAAATAATCTCAAAGGG - Intronic
1053681744 9:40490124-40490146 GGAGTGTACAGAAAGAGAAAAGG - Intergenic
1053931737 9:43118453-43118475 GGAGTGTACAGAAAGAGAAAAGG - Intergenic
1054281970 9:63134810-63134832 GGAGTGTACAGAAAGAGAAAAGG + Intergenic
1054294836 9:63325641-63325663 GGAGTGTACAGAAAGAGAAAAGG - Intergenic
1054392856 9:64630128-64630150 GGAGTGTACAGAAAGAGAAAAGG - Intergenic
1054427506 9:65135337-65135359 GGAGTGTACAGAAAGAGAAAAGG - Intergenic
1054502871 9:65886203-65886225 GGAGTGTACAGAAAGAGAAAAGG + Intronic
1054970775 9:71083553-71083575 GGATGGGAAAGTATGAAAAAAGG + Intronic
1054993408 9:71356311-71356333 GGGGTGGAAAGAATAATTAATGG - Intronic
1056418031 9:86396355-86396377 GCAGTGAAGAGAATGAGAAAAGG + Intergenic
1056480891 9:87004744-87004766 AGAGTGGAAAGATAGACAACAGG - Intergenic
1057693261 9:97306037-97306059 GGAACGGAAAGAATGACACCAGG - Intergenic
1058137700 9:101325692-101325714 GTAGTGGAAAGAATGAAATTTGG - Intergenic
1058258185 9:102796087-102796109 AGACAGGAAAGAAGGACAAAAGG - Intergenic
1059504261 9:114783493-114783515 GGAGTGGAAGCAATGAAAACAGG + Intergenic
1059599326 9:115759351-115759373 AGAGTGGAAAGAATTACCATGGG + Intergenic
1059842209 9:118230267-118230289 GGAGAGGAAAGAAGGAGAAAAGG - Intergenic
1060216180 9:121739816-121739838 GGAGTGGAAAGAATCACCAAAGG + Intronic
1060576411 9:124699766-124699788 GGAGTGGAAACAGGAACAAAGGG - Intronic
1061750554 9:132774048-132774070 GGAGTGGGGAGAAGGAGAAATGG - Intronic
1062078284 9:134604145-134604167 GGAGGGGAAAGAACGGAAAAGGG + Intergenic
1062093067 9:134688690-134688712 GGCGTGGGAACAGTGACAAAGGG - Intronic
1203678783 Un_KI270756v1:46019-46041 GGAATGGAAAGAAATGCAAATGG - Intergenic
1185963515 X:4573325-4573347 GGAGGGGAAAGAATAAAAAAGGG + Intergenic
1186611098 X:11139151-11139173 GGAGTGGGAGGGATGACAAGCGG - Exonic
1187025397 X:15430292-15430314 GAAATGGAAAGAAAGACGAAAGG - Intronic
1187276358 X:17819459-17819481 GGAGTGGAATGGCTGACAACAGG - Intronic
1187780466 X:22816861-22816883 GTAGTAGGAAGAATGAGAAATGG - Intergenic
1188090691 X:25961409-25961431 TGGCTGGAAATAATGACAAAGGG - Intergenic
1188703993 X:33303479-33303501 GGGATGGGAAGAATTACAAATGG + Intronic
1188855874 X:35195225-35195247 GGGATGGAAAGAATGAAAAGGGG - Intergenic
1188882129 X:35501829-35501851 GGAATGGAAAGATTGAGAAAGGG - Intergenic
1189197124 X:39162149-39162171 GGAGAGGAAAGAAGGAAAGAGGG - Intergenic
1191025260 X:55907570-55907592 GTAGTGGAAAGGGTGAGAAATGG + Intergenic
1191178792 X:57537228-57537250 GGAGGGGAGAGAAAGACAAGTGG + Intergenic
1192285377 X:69729451-69729473 GCAGTGGAGAGGATGAGAAATGG - Intronic
1192577903 X:72257621-72257643 GGGGTGGGAAGAAAAACAAAAGG + Intronic
1194737603 X:97531210-97531232 GGAGAGGAAGGAATGGGAAAGGG - Intronic
1195470681 X:105226362-105226384 GGAAAAGAAAGAATGGCAAAGGG - Intronic
1195712620 X:107786091-107786113 GGAGTGGAAAGTAGGGCAAATGG - Intronic
1196014590 X:110924045-110924067 GGAGTGGCAAGAATGGCCAGAGG + Intergenic
1196650080 X:118159373-118159395 GGAAGGGAAAGAAAGAAAAAAGG + Intergenic
1198440667 X:136660053-136660075 GGAGGGAAGAGACTGACAAAGGG - Exonic
1198636118 X:138702411-138702433 GGAGTGAACAGAATGAAAAATGG - Intronic
1200822969 Y:7606705-7606727 GAAGAGGAAAGAAAAACAAAAGG + Intergenic
1201132278 Y:10961455-10961477 GGAGTGGAATGGATGAGGAATGG - Intergenic
1202237086 Y:22724390-22724412 GAAGAGGAAAGAAAAACAAAAGG - Intergenic