ID: 925080608

View in Genome Browser
Species Human (GRCh38)
Location 2:1061192-1061214
Sequence AAGAATGACAAAAGGTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080603_925080608 9 Left 925080603 2:1061160-1061182 CCGCGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 2
4: 52
Right 925080608 2:1061192-1061214 AAGAATGACAAAAGGTGAACAGG 0: 1
1: 0
2: 3
3: 42
4: 516
925080606_925080608 0 Left 925080606 2:1061169-1061191 CCTGGGTTGGACGCTGGAGTGGA 0: 1
1: 1
2: 0
3: 12
4: 241
Right 925080608 2:1061192-1061214 AAGAATGACAAAAGGTGAACAGG 0: 1
1: 0
2: 3
3: 42
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080608 Original CRISPR AAGAATGACAAAAGGTGAAC AGG Intronic
901264398 1:7899021-7899043 AATCATGACAGAAGGTGAAGGGG + Intergenic
903179701 1:21598958-21598980 AAGAATGATAAAGGGTGTTCCGG + Intronic
904371515 1:30050430-30050452 ACTTATGACAAAAGGTGAAGAGG + Intergenic
905964466 1:42080727-42080749 AACCATGACAGAAGGTGAAGAGG + Intergenic
906115816 1:43356491-43356513 AAGAATGAAATAGGGAGAACGGG - Intergenic
906619755 1:47266352-47266374 AAAAATAAAAAAAGGTGAACTGG - Intronic
907798881 1:57744223-57744245 TAGAATGATAATTGGTGAACAGG + Intronic
907932328 1:59012125-59012147 AAGAATGACAAAACATGGCCGGG + Intergenic
908049003 1:60207414-60207436 AATCATGACAGAAGGTGAAGGGG + Intergenic
908469627 1:64430944-64430966 AAGAATGACAGAAGGTTGGCTGG - Intergenic
908508028 1:64825378-64825400 AAGACTTAGAAAAGGTGAAGTGG + Intronic
908605121 1:65790407-65790429 ACAGATGACAAAAGGAGAACAGG - Intergenic
908816029 1:68035453-68035475 AATCATGGCAGAAGGTGAACGGG + Intergenic
910416761 1:87009308-87009330 AAGAAGTAGGAAAGGTGAACAGG + Intronic
910600388 1:89025079-89025101 AAGAATGACACAAGGGGAAAAGG + Intergenic
911631771 1:100191697-100191719 AAGAAAGACAAAAGGTCTCCTGG + Exonic
911667138 1:100565738-100565760 AATCATGACAGAAGGTGAAGAGG - Intergenic
911718047 1:101158166-101158188 AAGAATGACAACAGGGTAAAGGG - Intergenic
911961162 1:104304259-104304281 AATCATGACAGAAGGTGAAGGGG + Intergenic
912066080 1:105745030-105745052 AAGAATGACAAAGGTAAAACAGG - Intergenic
912418358 1:109526867-109526889 AAGCATCATAGAAGGTGAACAGG + Intergenic
913015404 1:114728978-114729000 GAGAAAGACAAAAGATGAAAAGG - Intronic
913049265 1:115102542-115102564 AAGAATGACACTAGGGCAACTGG + Intergenic
913678389 1:121164598-121164620 AAGAATGACAAAATGGAAAAGGG + Intergenic
914030228 1:143952236-143952258 AAGAATGACAAAATGGAAAAGGG + Intronic
914159222 1:145115715-145115737 AAGAATGACAAAATGGAAAAGGG - Intergenic
914356953 1:146894737-146894759 AATCATGACAAAAGGGGAAGAGG + Intergenic
914690156 1:150018721-150018743 AAAAAAGACAAAAGGTGTAAAGG + Intergenic
915004567 1:152623948-152623970 AGGAATGACAAAAGGGAAGCAGG + Intergenic
915029951 1:152870782-152870804 AAGAAGGACAAAAGTAGAAGGGG + Intergenic
915043647 1:152991699-152991721 AAGAATGAGAATGGGTGGACTGG - Intergenic
916570486 1:166021796-166021818 AAGAAAGAAAATAGGTGAAATGG + Intergenic
916617198 1:166454286-166454308 AATCATGTCAAAAGGTGAAGGGG + Intergenic
916621055 1:166497961-166497983 AATCATGACAGAAGGTGAATGGG + Intergenic
918117640 1:181510606-181510628 AAGAAAGACAAAAGGGGCAAAGG - Intronic
918365141 1:183799579-183799601 AAGACTGACAAATGGCCAACAGG - Intronic
918591625 1:186246863-186246885 AATCATGACAAAAGGTGAAAGGG + Intergenic
918660851 1:187086790-187086812 AAGATAGACAAAAAATGAACTGG + Intergenic
919237582 1:194866224-194866246 AATCATGGCAAAAGGTGAAGGGG - Intergenic
919458380 1:197846791-197846813 AAGAATGAAAAAAAGAGAGCAGG + Intergenic
919535467 1:198781861-198781883 AAAAATAATAAAAGCTGAACAGG + Intergenic
920465695 1:206183121-206183143 AAGAATGACAAAATGGAAAAGGG + Intergenic
920490811 1:206413397-206413419 AAGAATGACAGCAGGTGAGCTGG + Intronic
921353439 1:214261611-214261633 AAGGGAGACAAAAGGTGGACTGG + Intergenic
922002245 1:221491393-221491415 AATCATGACAAAAGGTGAAGAGG + Intergenic
922381117 1:225027563-225027585 AATAATGGCAGAAGGTGAAGAGG + Intronic
923208699 1:231783418-231783440 AATAATGAAAAAATGAGAACAGG - Intronic
923634813 1:235684992-235685014 AAGAATGACAAAAGCAGGGCAGG - Intronic
924004905 1:239598743-239598765 AAGAATAAGAAAAGGGGAAAAGG - Intronic
924274395 1:242370796-242370818 AAAAATGACAAAATGCCAACTGG + Intronic
1062770301 10:94740-94762 AATAATGGCATAAGGTGAAAGGG + Intergenic
1063275496 10:4562832-4562854 GAGAATGACCAAAGGTGAACAGG - Intergenic
1063311975 10:4961163-4961185 AAGAATAAAGAAATGTGAACCGG - Intronic
1063315908 10:5006068-5006090 AAGAATAAAGAAATGTGAACAGG + Intronic
1063696582 10:8341352-8341374 AAGCATGGCAGAAGGTGAAGGGG + Intergenic
1064395654 10:14980104-14980126 AATAATATCACAAGGTGAACAGG - Intronic
1064414182 10:15134534-15134556 AAGTAGGACAAAAGGTGGCCAGG - Intronic
1064490565 10:15851391-15851413 GAGAATGGCAAAGGGTGAAGAGG - Intronic
1064530003 10:16298385-16298407 AATCATGACAGAAGGTGAAGGGG + Intergenic
1064636821 10:17377132-17377154 AGGAATGTCACAAGGTCAACTGG - Intronic
1064952613 10:20870899-20870921 AAGAGAGACAAAAATTGAACTGG + Intronic
1065668545 10:28088496-28088518 AAGCATGGCAGAAGGTGAAGGGG - Intronic
1067007937 10:42682260-42682282 AAGAAAGAAAAAAGATGCACAGG - Intergenic
1067130712 10:43562789-43562811 AAAAATGACAAAAGAAAAACAGG + Intronic
1067182179 10:43996587-43996609 AAGGATGAGACACGGTGAACTGG - Intergenic
1068352660 10:55869204-55869226 AAGAAAGAAATAAGGGGAACAGG - Intergenic
1069222272 10:65899540-65899562 AAGAAAGACAAAATGTGGCCAGG - Intergenic
1069342069 10:67422725-67422747 AGTAATGGCAAAAGGTGAAGAGG - Intronic
1069405421 10:68093593-68093615 AAGAAATACAAAAAATGAACCGG + Intergenic
1070580194 10:77713210-77713232 CAGAATTACAAAAGGTGAACCGG + Intergenic
1070856467 10:79611294-79611316 GAGAATGAAAAAAGATGAACGGG - Intronic
1071720662 10:88141360-88141382 AAGAATGGCAAAAGATTAAAAGG - Intergenic
1072589041 10:96810343-96810365 AAAATGGACAAAAGATGAACAGG + Intergenic
1074773200 10:116746453-116746475 AAGAATGAGAAAAGTACAACAGG + Intergenic
1075488162 10:122844509-122844531 AAGAAAGAGAAAAGGGGAAGAGG + Intronic
1077278414 11:1729355-1729377 AAGACTGACAGCAGGTGCACTGG + Intergenic
1078347700 11:10565653-10565675 AAGAAGGAAAAAAGAGGAACTGG - Intronic
1079135694 11:17775006-17775028 AAGCAGGAAAAAAGGTGAATGGG - Intronic
1079255681 11:18827095-18827117 AAGAATGAGAAATTCTGAACAGG - Intergenic
1079645191 11:22854416-22854438 AAGAATAAGAAAAGGGGAATGGG + Intronic
1079940692 11:26676938-26676960 AAATATGACACAAGGAGAACAGG + Intronic
1080459595 11:32441671-32441693 GAGAATGACTAAAGGTGAGATGG + Intergenic
1080548045 11:33341306-33341328 AGGAATGGCAAAAAGTGAATCGG - Intronic
1080831395 11:35896390-35896412 AATCATGACAGAAGGTGAAGGGG - Intergenic
1081325301 11:41737466-41737488 AATCATGACAGAAGGTGAAGGGG + Intergenic
1081405969 11:42698209-42698231 AAGAAAGAAAAAAGGAGAAAGGG + Intergenic
1082254711 11:50020795-50020817 AAAAATGAAAAAAAGAGAACTGG + Intergenic
1082705940 11:56495609-56495631 AAAAATGGCAAAATATGAACTGG - Intergenic
1084767366 11:71321439-71321461 AATCATGACAGAAGGTGAAAGGG - Intergenic
1086185078 11:84003511-84003533 AATTATGGCAGAAGGTGAACTGG + Intronic
1088048574 11:105482500-105482522 AAGAATGAGAATAGATGAAGAGG - Intergenic
1088419617 11:109630096-109630118 AAGACAGACAAAAGGTCAACAGG - Intergenic
1088655109 11:111991643-111991665 AAGCCTAACAAAAGGTGAGCTGG - Intronic
1088852391 11:113715569-113715591 AGGAATGACAGAAGGTCACCAGG + Intergenic
1089686985 11:120157568-120157590 AATCATGGCAAAAGGTGAAGAGG + Intronic
1090492016 11:127172878-127172900 AAGAAAGAGAAAAGGGGAAAAGG + Intergenic
1090721965 11:129483655-129483677 AAGAAAAAAAAAAGGTAAACAGG - Intergenic
1091598788 12:1903584-1903606 AAGAAAGACAAATGGCAAACAGG + Intronic
1091690439 12:2592877-2592899 AGGTATGAAAAAAGGTGACCAGG - Intronic
1091959776 12:4683698-4683720 AAGAAGGCCAAAAAGTGATCAGG + Intronic
1092582535 12:9859827-9859849 AAGAATGTTAAAAGGTTAATAGG + Intronic
1093150675 12:15617298-15617320 AAGAATTTTAAAAAGTGAACAGG - Intergenic
1093283173 12:17221970-17221992 AAGAAGGAAAAAAGATCAACGGG + Intergenic
1093424068 12:19008476-19008498 AAGAACATCAAAAGGTGAATAGG + Intergenic
1094815155 12:34176078-34176100 AAGACAGACAAATGGTAAACAGG - Intergenic
1095135335 12:38594344-38594366 AAGCATGACACAATGTGAAGTGG + Intergenic
1095350460 12:41204539-41204561 AACAATGACCAAAGGTAAAAGGG + Intronic
1096015059 12:48263768-48263790 AAGAATGGCAGAAGGTGAAGGGG + Intergenic
1097589321 12:61554374-61554396 ATGAATGCCTAAAGGTAAACAGG + Intergenic
1098337485 12:69419070-69419092 AAGAATGAGCAGAGGTGAGCAGG - Intergenic
1098626211 12:72672982-72673004 AAAAATAACAAAAGGAGGACAGG - Intergenic
1098734535 12:74082133-74082155 AATTATGGCAAAAGGTGAAGGGG - Intergenic
1098830951 12:75361627-75361649 AATCATGACAGAAGGTGAAGGGG + Intronic
1098959419 12:76723785-76723807 AAAATTGACAATATGTGAACTGG + Intergenic
1099114487 12:78607720-78607742 AAGACATACAAATGGTGAACAGG + Intergenic
1099530565 12:83774964-83774986 AAGACATACAAAAGGTCAACAGG + Intergenic
1099574833 12:84365104-84365126 AATTATGACAATAGGTGAAAGGG + Intergenic
1099865357 12:88273030-88273052 AAGAAGGACAAGTGGAGAACTGG + Intergenic
1100111662 12:91251542-91251564 AAGACAGACAAATGGTCAACAGG - Intergenic
1100460507 12:94794778-94794800 AATAATGACACAAGGACAACAGG + Intergenic
1100932953 12:99631861-99631883 AAGAATGAAAAAATGTGTTCAGG + Intronic
1100965377 12:100007316-100007338 AATCAAGACAAAAGGTGAACAGG + Intergenic
1101270473 12:103138449-103138471 AATCATGACAGAAGGTGAAGGGG - Intergenic
1101308460 12:103554660-103554682 AATTATGGCAAAAGGTGAAGGGG + Intergenic
1101741555 12:107503788-107503810 AAGAAAGAGAAAAAGAGAACTGG + Intronic
1102752353 12:115306465-115306487 AAGAATGACAGAAGATGAAAGGG + Intergenic
1102995172 12:117343795-117343817 AAGGCTGACAAAAGGTGCTCAGG + Intronic
1104112196 12:125714553-125714575 AATCATGGCAGAAGGTGAACTGG - Intergenic
1106607928 13:31248975-31248997 AAGAATTCCAAAAAGTGATCAGG - Intronic
1107637037 13:42402627-42402649 AAGAAGAACAAAAGGTCAGCTGG - Intergenic
1108910851 13:55550018-55550040 AATCATGACAAAAGGTGAATAGG - Intergenic
1109171851 13:59107164-59107186 AAGAAGCTCAAAAGGTGACCTGG + Intergenic
1109324523 13:60851914-60851936 AATCATGGCAGAAGGTGAACGGG + Intergenic
1109551218 13:63902885-63902907 AAACATGACAGAAGGTGAAGGGG + Intergenic
1109970727 13:69764891-69764913 AAGCATGAGAAAAGGAGAAAAGG - Intronic
1110342428 13:74408182-74408204 AAGCATGGCAGAAGGTGAATGGG - Intergenic
1110448932 13:75619169-75619191 AATCATGGCAAAAGGTGAAGAGG + Intergenic
1110663732 13:78090760-78090782 AAGACATACAAATGGTGAACAGG + Intergenic
1111065863 13:83090236-83090258 AAAAATGACAAAAGGCAAAGGGG - Intergenic
1111185861 13:84735048-84735070 AATCATGGCAAAAGGTGAAGAGG - Intergenic
1111457904 13:88507970-88507992 AATCATGGCAAAAGGTGAAAGGG + Intergenic
1111956690 13:94766695-94766717 AATAATGGCAGAAGGTGAAGGGG + Intergenic
1112252097 13:97791893-97791915 AATCATGGCAAAAGGTGAAAGGG + Intergenic
1112445527 13:99461067-99461089 AATCATGACAGAAGGTGAAGGGG - Intergenic
1112919442 13:104593506-104593528 AAGAATATCATAAGGTGGACAGG - Intergenic
1113527033 13:110987898-110987920 AATCATGGCAAAAGGTGAAGAGG - Intergenic
1113823336 13:113231317-113231339 AAGAATGAGCAAAGGTGGTCAGG + Intronic
1114572130 14:23678683-23678705 AAGAATGAAAAAAGATATACAGG + Intergenic
1114687747 14:24549901-24549923 AAGAAATCCAAAACGTGAACAGG - Intergenic
1115134463 14:30091933-30091955 AATAATGGCAGAAGGTGAAGGGG + Intronic
1115311989 14:31987979-31988001 AATCATGACAGAAGGTGAAGGGG - Intergenic
1115616001 14:35095542-35095564 AAGAATGCCAAAAGGAGGTCGGG + Intronic
1115865884 14:37746211-37746233 AAGAATGACAGTGGGGGAACGGG - Intronic
1116476067 14:45341126-45341148 AATCATGGCAAAAGGTGAAGGGG + Intergenic
1117003233 14:51393084-51393106 ACAAAAGACAAAAGGTGAAGAGG - Intergenic
1117693958 14:58339793-58339815 AATCAGGACAAAAGGTGAAGGGG + Intronic
1117855431 14:60026380-60026402 AAGAAATACAAATGGTCAACAGG - Intronic
1119154952 14:72401525-72401547 AAGAATGAGAAGAGCTGGACTGG + Intronic
1120047739 14:79827612-79827634 AATCATGGCAAAAGGTGAAGGGG + Intronic
1120120215 14:80669969-80669991 AATCATGACATAAGGTGAAGGGG + Intronic
1120257600 14:82140234-82140256 AATAATGACAGAAGGTGAAGTGG - Intergenic
1120385668 14:83842381-83842403 AAGAATGAGAAAATGTGAGGGGG + Intergenic
1120392445 14:83925380-83925402 AATCATGGCAAAAGGTGAAGGGG - Intergenic
1120619229 14:86742604-86742626 AAGACATACAAATGGTGAACAGG - Intergenic
1121097583 14:91228610-91228632 TAGAATGACAAAGGGAGACCTGG - Intergenic
1121130742 14:91444405-91444427 AAGAAATCCAAAACGTGAACAGG + Intergenic
1124027671 15:25981933-25981955 AAGAATGTCAACAGGTGGCCTGG + Intergenic
1124417803 15:29488391-29488413 AAAAATGATAAAAGATTAACAGG + Intronic
1124819253 15:33027963-33027985 CAAAATGAGAAAAGATGAACTGG + Intronic
1125248123 15:37665665-37665687 AAGAAAGAAAAAAGATGAAGAGG - Intergenic
1125249597 15:37684627-37684649 AAGAATGAAAAAAGGTGGGGAGG + Intergenic
1125624120 15:41092297-41092319 AAGCATGTCATAAGGGGAACTGG - Intronic
1125906149 15:43394435-43394457 AAGAAAAACAAAAGGTAAACTGG - Intronic
1126140208 15:45431182-45431204 GAGAATGCCAAATTGTGAACTGG + Intronic
1126622324 15:50652455-50652477 AATAATGAGAAAAACTGAACAGG + Intronic
1127448248 15:59088195-59088217 AAGCATGACCCAGGGTGAACAGG + Intronic
1131423509 15:92326710-92326732 AAGAATGAACAAAGGGGAAATGG - Intergenic
1131651516 15:94404600-94404622 AAGAATGAAAGAAGATGAAACGG - Intronic
1131748976 15:95485140-95485162 AAAAATAACAGAAGGAGAACTGG - Intergenic
1132533158 16:463736-463758 AAGAGTAACAAATGGGGAACAGG - Intronic
1135241791 16:20813732-20813754 AAGAAAGAAAAAAGATTAACTGG - Intronic
1135681972 16:24465203-24465225 AATCATGACAGAAGGTGAAGTGG + Intergenic
1136623495 16:31446091-31446113 AATAATGGCAGAAGGTGAAGGGG + Intergenic
1139189491 16:64845067-64845089 ATGAATGAAAAAAAGTGAAAAGG - Intergenic
1140180504 16:72712427-72712449 AATAATAACAAAAAGAGAACAGG - Intergenic
1141243741 16:82287377-82287399 AAGAATGAAAGAAGGTCAAAGGG + Intergenic
1141685312 16:85566676-85566698 AAGAATGACAAGAGGTGGGGAGG - Intergenic
1142948768 17:3460261-3460283 AAGACTCAAAAAAGGTGAAATGG + Intronic
1143578063 17:7806744-7806766 AAGAATCAGAAAATGGGAACCGG + Intronic
1143893421 17:10119178-10119200 AAGAATGTCAGAAGGTGATCGGG + Intronic
1144030118 17:11312340-11312362 AAAAATTACAAAATGTGAAAAGG - Intronic
1144042606 17:11426193-11426215 AATAGTGACAGAAGGTGAAAGGG + Intronic
1144136086 17:12296376-12296398 AAAAAAGACAGAAGGAGAACAGG + Intergenic
1145401147 17:22534255-22534277 AAGAATGACAAAGGGAAAAAAGG - Intergenic
1146989743 17:37258615-37258637 AGAAATGACAACAGGGGAACTGG - Intronic
1147894558 17:43742076-43742098 AATCATGTCAAAAGGTGAAGGGG + Intergenic
1149047200 17:52260867-52260889 AATTATGACAGAAGGTGAAAGGG + Intergenic
1149219365 17:54398376-54398398 AAGAATGGCAGAAGGTGAAGGGG - Intergenic
1149895255 17:60423999-60424021 AAGCATGACAGAAGATGAAGAGG + Intronic
1149930302 17:60746407-60746429 AAGAAGAACAAAAGGTAAAGAGG - Intronic
1150673187 17:67220308-67220330 AAGAATCTCAAAAGCTGAAGGGG - Intronic
1150922352 17:69496662-69496684 AAGAATGAAAGAAGGTGGCCAGG - Intronic
1152526989 17:80893981-80894003 AAGAAAGAATAAAGGTCAACAGG + Intronic
1153574390 18:6506277-6506299 AAGATGGAGAAGAGGTGAACTGG - Intergenic
1153692167 18:7604755-7604777 AAGTATGGCACCAGGTGAACAGG - Intronic
1153828597 18:8899773-8899795 TACAAAGACAAAAGGTGTACTGG + Intergenic
1155008015 18:21746697-21746719 AAGAATGACAGAACCTTAACAGG - Intronic
1155436706 18:25820020-25820042 AAGAAGGAGAAAAGGGGAACTGG + Intergenic
1155650996 18:28141640-28141662 CAGAATGACAAGAGGGGAAGGGG - Intronic
1156304508 18:35864527-35864549 AACTATGGGAAAAGGTGAACTGG - Intergenic
1156982754 18:43310355-43310377 TAGAATTACAAAAGCTGAGCAGG - Intergenic
1157240778 18:46007769-46007791 AGGAATGATAGGAGGTGAACAGG - Intronic
1159140973 18:64394073-64394095 AAGAAGGACAAAAAGTAAAAGGG + Intergenic
1159528345 18:69623181-69623203 AATAATGACAGAAAGTGAAGGGG - Intronic
1159644864 18:70905853-70905875 AAGGATGACAAAAGGAGTCCTGG - Intergenic
1161235817 19:3197601-3197623 AAGAATTACAAAAGATTAGCTGG - Intronic
1164088468 19:21926191-21926213 ATGAATGACATAGGGTGACCTGG - Intergenic
1164191496 19:22921887-22921909 ATGAATGACATAGGGTGAACTGG - Intergenic
1165474172 19:36020089-36020111 AAGAAAGAAAAAAGGTAACCAGG + Intronic
1165839133 19:38776731-38776753 AAAATTGAAAAAAGGTGACCAGG - Intergenic
1166521527 19:43483671-43483693 AAGAATGTGAAAAAGTCAACAGG + Intronic
1167125127 19:47544329-47544351 AAGGATCACAAAAGGTGAAAAGG - Exonic
1168464145 19:56588786-56588808 AATCATGGCAAAAGGTGAAAGGG - Intronic
925080608 2:1061192-1061214 AAGAATGACAAAAGGTGAACAGG + Intronic
927144537 2:20153967-20153989 AATCATGGCAAAAGGTGAAGGGG - Intergenic
927394312 2:22631664-22631686 AATCATGAGAAAAGGAGAACTGG - Intergenic
927813844 2:26196660-26196682 ATGAATGACAAAAGGCAAGCAGG + Intronic
929132208 2:38588024-38588046 AATCATGGCAAAAGGTGAAGGGG - Intronic
929176159 2:38978673-38978695 AAGAATGGCAAGAGAGGAACTGG - Intergenic
929811101 2:45190036-45190058 AATCATGGCAAAAGGTGAAGGGG - Intergenic
931511096 2:62995712-62995734 AAAAATGTCAAAAGGTAAACAGG + Intronic
931713895 2:65013054-65013076 AAGCATGGCAGAAGGTGAAGGGG + Intronic
934911771 2:98264527-98264549 AATAATAACAAAAGGAAAACTGG - Intronic
935260383 2:101350776-101350798 CAGAATGAGAGAGGGTGAACAGG - Exonic
935432421 2:102990388-102990410 AAGAATGAGAGAAAGTGACCAGG + Intergenic
935985924 2:108673213-108673235 AAGCATGGCAAAATGTCAACTGG - Intronic
936138359 2:109916840-109916862 AAGCATGGCAAAATGTCAACTGG - Intergenic
936206337 2:110454645-110454667 AAGCATGGCAAAATGTCAACTGG + Intronic
938042335 2:128085968-128085990 AATTATGACAGAAGGTGAAGGGG + Intergenic
938755598 2:134376288-134376310 AAGAAGGAGAAAAGGAGAAAGGG - Intronic
938953055 2:136274649-136274671 AAGGAAGACAAAAGGCCAACAGG + Intergenic
942118357 2:172750762-172750784 AAGACAAACAAATGGTGAACAGG - Intronic
942482532 2:176404571-176404593 AATAATGGCAGAAGGTGAAAGGG + Intergenic
943107205 2:183560428-183560450 AATAATGGCAGAAGGTGAAAGGG + Intergenic
943373064 2:187040570-187040592 AATTATGGCAGAAGGTGAACAGG - Intergenic
943431390 2:187806693-187806715 AAGAAAGAGAAAAGATAAACTGG + Intergenic
946289382 2:218732307-218732329 AAGAAAGACAACAGGAGAAAAGG - Intronic
946503605 2:220275902-220275924 AATAATGGCAGAAGGTGAACGGG + Intergenic
946531392 2:220574184-220574206 AATCATGACGAAAGGTGAAGGGG + Intergenic
946550979 2:220801715-220801737 AATAATGGCAGAAGGTGAAGTGG + Intergenic
946846792 2:223866215-223866237 GAGAGTGACTGAAGGTGAACAGG + Intronic
947102342 2:226634747-226634769 AAGAATGACAAAAGTTGATTTGG - Intergenic
947181121 2:227412274-227412296 AAGACTCCCATAAGGTGAACAGG - Intergenic
948446038 2:238033649-238033671 CAGAAAGACAAAAGGTGGGCAGG - Intronic
1168862732 20:1057662-1057684 AATAAAGACCAAAGGTGAAAAGG - Intergenic
1168930829 20:1622602-1622624 AAAAATGGCAAAAGGTGAAGGGG + Intergenic
1169284000 20:4292156-4292178 AAGAAAGCCAAAAGATGAACAGG - Intergenic
1169946182 20:10991463-10991485 AAGAATCAGAAAAGTTGAAATGG + Intergenic
1170638282 20:18128702-18128724 AATCATGACAGAAGGTGAAGGGG + Intergenic
1171445587 20:25201581-25201603 AAGAGTGACCAAAGGAGAGCAGG - Intronic
1174087559 20:48019904-48019926 AAGACTGATAAAAGGTGCACAGG - Intergenic
1175010354 20:55728538-55728560 AATCATGGCAGAAGGTGAACGGG + Intergenic
1175461515 20:59155166-59155188 AACAATGACAAAAGCCAAACAGG - Intergenic
1176918471 21:14656250-14656272 AAGAAGGACAAATGGGGAGCAGG + Intronic
1177186897 21:17807331-17807353 AATCATGACAGAAGGTGAAGGGG - Intronic
1177214700 21:18113512-18113534 AATCATGGCAAAAGGTGAAGGGG + Intronic
1178178441 21:30132033-30132055 AATAATGGCAGAAGGTGAAGGGG + Intergenic
1178218118 21:30624488-30624510 AATCATGGCAAAAGGTGAAGAGG + Intergenic
1178614634 21:34121162-34121184 AAGAATGACATCAGGAGAACTGG + Intronic
1179266548 21:39808404-39808426 AATAATGGCAGAAGGTGAAGGGG - Intergenic
1181540767 22:23572094-23572116 AATAATGACGGAAGGTGAAGGGG + Intergenic
1181851976 22:25755883-25755905 AAGAAAGAAAAAAGTTCAACTGG - Intronic
1181889232 22:26047027-26047049 AAGAGTTACAAGAGGTGAAAGGG + Intergenic
1181896541 22:26113150-26113172 AATCATGACAGAAGGTGAACGGG + Intergenic
1184202109 22:42977397-42977419 AATAAAGAAAAAAGGTGAAATGG + Intronic
1184345723 22:43911468-43911490 AAGCATGACATAAGGTCACCAGG - Intergenic
1184350225 22:43938484-43938506 AATCATGGCAGAAGGTGAACGGG + Intronic
1184575286 22:45359309-45359331 AAGAAAGAAAAAAGGCCAACAGG + Intronic
1184589013 22:45468613-45468635 AATAATGGCAGAAGGTGAAGGGG + Intergenic
1184909974 22:47525217-47525239 AATCATGTAAAAAGGTGAACAGG + Intergenic
1203292426 22_KI270736v1_random:8427-8449 AATCATGGCAAAAGGTGAAGGGG + Intergenic
949093177 3:53863-53885 AAAGAAGACAAAAGGTCAACTGG + Intergenic
949301078 3:2584720-2584742 AAGAATAAAAAAAAGGGAACAGG + Intronic
949375124 3:3380674-3380696 AAGAATGATAAAAGGAAAAGAGG - Intergenic
949595343 3:5538554-5538576 AATCATGGCAAAAGGTGAAGCGG + Intergenic
950025475 3:9817126-9817148 AAGAATGAGAAAGGGTGGGCCGG + Intronic
951128499 3:19012815-19012837 TAGCATGACAGAAGGTCAACAGG - Intergenic
951271189 3:20626517-20626539 AATCATGGCAAAAGGTGAAGAGG + Intergenic
951279349 3:20728853-20728875 AAGAATTCCAAAATCTGAACAGG - Intergenic
952118890 3:30217502-30217524 AAGAGAGAAAAAAGATGAACTGG - Intergenic
953533803 3:43761571-43761593 AACAATGACAAAAATTCAACAGG - Intergenic
955186754 3:56721647-56721669 AATCATGACAGAAGGTGAAGGGG - Intergenic
955705148 3:61720021-61720043 TAGAATGACAAATGGTGCCCAGG - Intronic
956235697 3:67068755-67068777 AAAAATGGCAGAAGGTGAAAGGG + Intergenic
956612624 3:71139807-71139829 AGGAATGGGAAAAGGTGAACAGG + Intronic
956622321 3:71233746-71233768 AAGAAGGACAAAAGAGGATCAGG + Intronic
957033442 3:75269932-75269954 AAAGAAGACAAAAGGTCAACTGG + Intergenic
957215511 3:77315794-77315816 AAGAATGATAAAAGGCAAAAGGG + Intronic
957446561 3:80319417-80319439 AAGAATGCCACAATGTGATCTGG + Intergenic
957977371 3:87464226-87464248 AAAAAATACAAAAGGTTAACAGG + Intergenic
958175135 3:89988302-89988324 AATTATGGCAAAAGGTGAAGGGG - Intergenic
958183213 3:90085682-90085704 CAGAATGCTACAAGGTGAACAGG + Intergenic
958189028 3:90160605-90160627 AAGAGTGAAAAAAGTGGAACAGG - Intergenic
958715276 3:97773255-97773277 AAAAATGTGAAAAGGTAAACTGG - Intronic
958764895 3:98355332-98355354 AAGAATGAAAAAAAATGAAAAGG + Intergenic
959807085 3:110568307-110568329 AAGAAAGACAGAAGCTGGACAGG + Intergenic
959868262 3:111296612-111296634 AAAAAAGACAAAAGATCAACAGG - Intronic
960121206 3:113949855-113949877 AAGAACGACAAAGGGTTCACTGG - Intronic
963416585 3:145002627-145002649 AATCATGACAGAAGGTGAAGCGG + Intergenic
964718894 3:159752107-159752129 AATCATGACAGAAGGTGAAGGGG - Intronic
965435891 3:168650823-168650845 AAGAATGACAAATGGGAAAAGGG - Intergenic
966583936 3:181600377-181600399 AAGACAGACAAATGGTCAACAGG - Intergenic
967364096 3:188666012-188666034 AAGAATGGCAAAATGTCAAAGGG - Intronic
967856405 3:194120963-194120985 AAGACTGACATAAGGGGAAGCGG + Intergenic
969846057 4:9920895-9920917 AATGATAACAAAAGATGAACAGG - Intronic
970749648 4:19342248-19342270 AATCATGGCAGAAGGTGAACAGG - Intergenic
971076880 4:23159632-23159654 AAGAATGACAGGAGTTGAATAGG + Intergenic
971170218 4:24226086-24226108 CAGAATGGCAAAAGGGGAAATGG - Intergenic
971212669 4:24634698-24634720 AAGTATGAAAAAGGGTGAAAAGG - Intergenic
971800284 4:31280831-31280853 AAGACTTACAAAAGGCCAACAGG - Intergenic
971852999 4:32008275-32008297 AATAATGACAGAAGGTGAAGGGG - Intergenic
971955959 4:33418768-33418790 CACAATGACAAAAGGTGTAATGG - Intergenic
972170738 4:36342538-36342560 AACCATAACAACAGGTGAACAGG + Intronic
972183114 4:36493969-36493991 AAGAAGGGCAAATGGTAAACTGG + Intergenic
972802637 4:42493375-42493397 ATGAATGATAAAAGTTAAACAGG + Intronic
972909876 4:43801226-43801248 AATAATGGCAAGAGGTGAAGGGG + Intergenic
972984110 4:44742922-44742944 CAGAATGACAAAGGGTGGAGAGG - Intergenic
973162497 4:47035674-47035696 AGGACTGACTAAAGATGAACAGG + Intronic
973262522 4:48179131-48179153 AAGAATGACAAAAAGACAATAGG + Intronic
973941162 4:55911776-55911798 AAAAAAGACAAAAAGTGAACAGG + Intergenic
973967151 4:56174889-56174911 AATCATGACAGAAGGTGAAGGGG + Intronic
973995371 4:56453256-56453278 AAGAATGACACCATCTGAACAGG - Intronic
974395952 4:61335401-61335423 ATGAATGAGAAAAGATGAAGTGG - Intronic
974674235 4:65070033-65070055 AAGAATGACAAAATACAAACCGG - Intergenic
974867241 4:67596275-67596297 AATCATGACAGAAGGTGAAGGGG - Intronic
975637525 4:76464819-76464841 AATCATGGCAAAAGGTGAAGGGG - Intronic
975862343 4:78690838-78690860 AAGAATGAGAAAAGGGGAATTGG - Intergenic
976154387 4:82126774-82126796 AATAATGGCAGAAGGTGAAGGGG - Intergenic
976452131 4:85202137-85202159 AACAATCACAAAAGATGAAAGGG - Intergenic
976507782 4:85869368-85869390 AAGAATGACAAAAATTGCATAGG - Intronic
976633935 4:87268493-87268515 AAAAGTGAGAAATGGTGAACAGG + Intergenic
976840469 4:89426736-89426758 AATCATGGCAAAAGGTGAAGGGG + Intergenic
977321836 4:95525982-95526004 ATGAAAGACTAAAGGTGCACAGG + Intronic
977552450 4:98456845-98456867 AATCATGACAGAAGGTGAAGGGG + Intergenic
977720004 4:100229025-100229047 AAGTATGGCAAAAGGTGAAGGGG - Intergenic
978408497 4:108404785-108404807 AATAATGGCAGAAGGTGAAGGGG + Intergenic
978458930 4:108928925-108928947 AAGACTGAAATCAGGTGAACTGG + Intronic
979319152 4:119302183-119302205 AAGCATGACATAAACTGAACAGG + Intronic
979555378 4:122040678-122040700 AATCATGACAGAAGGTGAAGGGG + Intergenic
979602094 4:122597121-122597143 AAGCATGGCAGAAGGTGAAGTGG + Intergenic
979787601 4:124735504-124735526 AATCATGGCAAAAGGTGAAGGGG - Intergenic
979817573 4:125129056-125129078 AATAATAAAAAAAGGTGAGCTGG - Intergenic
979868975 4:125792579-125792601 AAGAAAGATAAAAGGAGAAGAGG - Intergenic
980523041 4:133956762-133956784 AATCATGGCAAAAGGTGAAAGGG + Intergenic
981063445 4:140453761-140453783 AATCATGACAGAAGGTGAAGAGG - Intronic
982400874 4:154966475-154966497 AATCATGACAGAAGGTGAAGGGG - Intergenic
983517782 4:168675528-168675550 AAGAATGGCCAAAGTTAAACTGG - Intronic
983780508 4:171664825-171664847 AAGAATTACAAAATATGAACAGG + Intergenic
984019605 4:174469076-174469098 ATGAATGAGTAAAGGTGAAAGGG - Intergenic
984230429 4:177091092-177091114 AATAATGACAACAGGTAAATGGG + Intergenic
985321851 4:188721614-188721636 AAGAATGAGAAGGGGAGAACAGG + Intergenic
986918159 5:12650361-12650383 AAGAAGGACAAAAGCAGAAAGGG + Intergenic
987123041 5:14785456-14785478 AATCATGGCAGAAGGTGAACGGG - Intronic
987663448 5:20906433-20906455 AATCATGGCAAAAGGTGAAGAGG + Intergenic
987726977 5:21716016-21716038 AATCATGACACAAGGTGAAGGGG + Intergenic
987912070 5:24160644-24160666 AAGACATACAAATGGTGAACAGG + Intronic
988322225 5:29713309-29713331 AATCATGACAGAAGGTGAATGGG + Intergenic
988445100 5:31276987-31277009 AAGAAGAGCCAAAGGTGAACAGG + Intronic
988608866 5:32706189-32706211 AAGAATGGCAGAAGGCGAAGGGG - Intronic
988759234 5:34295754-34295776 AATCATGGCAAAAGGTGAAGAGG - Intergenic
988946218 5:36203387-36203409 AAAAAGGACAAAAGATGAATGGG + Intronic
990266064 5:54077113-54077135 ATGAATGACAATATGTTAACAGG - Intronic
990268300 5:54104087-54104109 AAGAATGGAAAGAGGGGAACGGG - Intronic
990532835 5:56690676-56690698 AAGGATCACAAGAGCTGAACAGG + Intergenic
991441078 5:66649969-66649991 AAGAAAAAAAAAAGGTGAATTGG - Intronic
992648771 5:78836871-78836893 AATCATGACAGAAGGTGAAGAGG + Intronic
992997980 5:82351015-82351037 AAGATTGACAGATGATGAACTGG + Intronic
993144605 5:84078338-84078360 AAGAATCAGAAATGATGAACTGG + Intronic
993226718 5:85175854-85175876 AATCATGACAGAAGGTGAAGAGG - Intergenic
993251126 5:85524401-85524423 AATAATGGCAGAAGGTGAAGAGG - Intergenic
993777141 5:92013199-92013221 AATCATGACACAAGGTGAAGGGG - Intergenic
993848210 5:92972305-92972327 AATGATGGCAAAAGGTGAAGGGG + Intergenic
994505119 5:100633033-100633055 TAGAATGACAAAATTTGAAGAGG - Intergenic
994920915 5:106041966-106041988 GGGAGTGACAAATGGTGAACTGG - Intergenic
995288366 5:110418687-110418709 AAGTAAGAAAGAAGGTGAACAGG + Intronic
995929204 5:117415920-117415942 AAGAATGACAACAGAAGAAGAGG + Intergenic
996013551 5:118506863-118506885 AAGAAAGAAAAAAAGAGAACAGG - Intergenic
996216433 5:120872168-120872190 AATCATGACAGAAGGTGAAGGGG - Intergenic
996574547 5:124966986-124967008 AAGAATGACAAAAGTGAAAATGG - Intergenic
996667497 5:126076909-126076931 AATCATGACAGAAGGTGAAGGGG + Intergenic
997765611 5:136500430-136500452 AAGAATAACAAAATGTGAACAGG - Intergenic
998499567 5:142620481-142620503 AAGAATGACTAAAGATAAAAGGG + Intronic
998733917 5:145112978-145113000 AAGAATGACAAAAGTCAACCAGG + Intergenic
999533787 5:152493832-152493854 AATCATGACAGAAGGTGAAGAGG + Intergenic
1000436557 5:161217695-161217717 AAGAATGAAAACAAGTTAACAGG + Intergenic
1001126337 5:169022922-169022944 AAAATGGGCAAAAGGTGAACAGG + Intronic
1001342050 5:170856071-170856093 AAGAATGAATAAAGGTGGCCAGG - Intergenic
1001448207 5:171803664-171803686 AAAAAGGCCAAAATGTGAACAGG + Intergenic
1002032502 5:176440894-176440916 ACTTATGACAAAAGGTGAAGGGG + Intergenic
1003227089 6:4215787-4215809 ACTCATGGCAAAAGGTGAACGGG - Intergenic
1005422830 6:25670706-25670728 AAGGATGACATGAGGGGAACAGG - Intronic
1005908037 6:30283011-30283033 AATCATGACAAAAGGTGAAGGGG + Intergenic
1006640678 6:35488124-35488146 AGGAATTACAAAAAGGGAACTGG + Intronic
1007747526 6:44052040-44052062 AAGGGTGCGAAAAGGTGAACAGG - Intergenic
1007840278 6:44710517-44710539 AAGAAAGAAAAAAGATTAACTGG + Intergenic
1008631671 6:53367888-53367910 AATCATGGCAAAAGGTGAATAGG + Intergenic
1008638501 6:53436676-53436698 CAGAATGTAAAATGGTGAACGGG - Intergenic
1009608464 6:65905463-65905485 AATCATGACGAAAGGTGAAGTGG + Intergenic
1009609474 6:65922269-65922291 AAAAATGACAAATGGTGACAAGG + Intergenic
1009761726 6:68015163-68015185 AAGAATGACAAATGGTAGGCAGG + Intergenic
1009810292 6:68653799-68653821 AGGAAGGACAAAAAGAGAACAGG - Intronic
1009854250 6:69240547-69240569 CAGAATGACTAAAGGTGAGAGGG + Intronic
1009929493 6:70160212-70160234 AATCATGACAGAAGGTGAAGAGG + Intronic
1009993507 6:70873721-70873743 AAGAATGACGAAAAATGAACAGG - Intronic
1010470522 6:76221938-76221960 AAAAATGACAAAAGAAAAACAGG - Intergenic
1011041311 6:83032888-83032910 AATCATGGCAAAAGGTGAAGGGG - Intronic
1011575811 6:88797788-88797810 TAGAATGACAGAAGGAGAAAGGG + Intronic
1012210098 6:96508919-96508941 AAGCATGGCAGAAGGTGAAGAGG - Intergenic
1012594481 6:101023793-101023815 AGGAATGACACCAGGTGAAGCGG - Intergenic
1013335903 6:109161010-109161032 AAGAATGCTAAAAGGGTAACTGG - Intronic
1013992314 6:116267804-116267826 AATCATGACAGAAGGTGAAGGGG + Intronic
1014433014 6:121391275-121391297 AATCATGGCAAAAGGTGAAGGGG + Intergenic
1014567170 6:122963845-122963867 AAAAATGACAGATGCTGAACAGG + Intergenic
1014724512 6:124959014-124959036 AAAAATAACAAAAGGTGGCCAGG + Intergenic
1015107883 6:129558089-129558111 AAGAATGACAAACTCTGAATGGG - Intergenic
1015456990 6:133437684-133437706 AATTATGGCAAAAGGTGACCGGG + Intronic
1015613599 6:135052005-135052027 ATGAATGACAAAACTAGAACCGG + Intronic
1015934672 6:138396793-138396815 AATCATGGCAAAAGGTGAAGGGG + Intergenic
1016076124 6:139797542-139797564 AATCATGACAGAAGGTGAAGGGG - Intergenic
1016613886 6:146025019-146025041 AATCATGGCAAAAGGTGAAGGGG - Intergenic
1016639775 6:146335547-146335569 AAGAAAGAGAAAAGGGGAACAGG - Intronic
1017067083 6:150539097-150539119 AAAAATGAGAAAAGGAGAAATGG - Intergenic
1017578566 6:155834570-155834592 AAGAGAGACTCAAGGTGAACTGG - Intergenic
1017637156 6:156454787-156454809 AATCATGGCAAAAGGTGAAGGGG + Intergenic
1017812408 6:157993307-157993329 AAGAAATACAAATGGTAAACAGG - Intronic
1018104395 6:160469076-160469098 AAGACTTATAAAAGCTGAACTGG + Intergenic
1018565885 6:165152872-165152894 AACAATAACAAAATGTGAAAAGG + Intergenic
1018730299 6:166645257-166645279 AAGAATGGCAAAGGGTGACCAGG + Intronic
1019172865 6:170144090-170144112 AATCATGACAGAAGGTGAAGCGG - Intergenic
1020504717 7:8969991-8970013 AAGAATGAGAAAAGGTCGGCAGG + Intergenic
1020711576 7:11612875-11612897 AGGAAATACAAAAGGTCAACAGG - Intronic
1021380469 7:19959808-19959830 AATCATGGCAAAAGGTGAAGGGG - Intergenic
1022818963 7:33939731-33939753 AATCATGGCAAAAGGTGAAGGGG - Intronic
1023284478 7:38604954-38604976 AAAAATGACAAAGGATTAACAGG + Intronic
1023364193 7:39446717-39446739 CAGAATGACAAATGGAGCACAGG - Intronic
1024400071 7:48913965-48913987 AATCATGACAGAAGGTGAAGGGG - Intergenic
1024882139 7:54099181-54099203 TAAAATTTCAAAAGGTGAACAGG + Intergenic
1026336336 7:69397151-69397173 GAAAATGACAAAAGATGAAGTGG + Intergenic
1026384725 7:69834856-69834878 AAGAAAAGCAAAAGGTAAACTGG - Intronic
1027441077 7:78219759-78219781 AGGAATGACAGAATGTGAAAGGG - Intronic
1027559730 7:79713637-79713659 AAGAATGACATAAAGTAACCTGG - Intergenic
1027578814 7:79966530-79966552 AAGAATCACAAAAGAAAAACAGG + Intergenic
1027751693 7:82155743-82155765 AAAAATGACAAAGAGTGAAAAGG + Intronic
1028076958 7:86528472-86528494 AAGAATAACAAACGGTGAGGAGG - Intergenic
1028874006 7:95800329-95800351 AAGAAAGACAAGGGGTGAAATGG + Intronic
1029354585 7:100042326-100042348 AAAAAAAAAAAAAGGTGAACTGG + Intergenic
1029479999 7:100806576-100806598 AAAAAGGAGAAAAGGTGAGCTGG + Intronic
1029701788 7:102251781-102251803 AAGAATGAAAAGAAGTTAACAGG + Exonic
1030513052 7:110508653-110508675 AATCATGACAGAAGGTGAAGGGG + Intergenic
1030752012 7:113240359-113240381 AAGCATGGCAGAAGGTGAATGGG - Intergenic
1030752831 7:113251976-113251998 AAGAAATCCAAAACGTGAACAGG + Intergenic
1031107349 7:117561278-117561300 AATAATGAAAAAAGGAGAAGAGG + Intronic
1031310765 7:120194447-120194469 AATCATGACAGAAGGTGAAGAGG - Intergenic
1031518447 7:122731650-122731672 AAGAAAAAAAAAAGGTGAAGAGG + Intronic
1031618108 7:123904773-123904795 AATAATGATGAAAGGTGAAAAGG + Intergenic
1032226906 7:130039422-130039444 ATGAAGGAAAAATGGTGAACAGG + Intronic
1035121536 7:156572686-156572708 AAGGAGGAGAAAAGGTGAAAGGG + Intergenic
1035149030 7:156851040-156851062 AATCATGACAGAAGGTGAAGTGG - Intronic
1036052703 8:5217801-5217823 AATCATGACAGAAGGTGAAGGGG + Intergenic
1036123009 8:6038354-6038376 AATCATGACAGAAGGTGAAGAGG + Intergenic
1036718111 8:11145636-11145658 AAATCTGACAAAAGGTGCACAGG + Intronic
1038074987 8:24062146-24062168 AAGACTTACAAATGGTAAACAGG + Intergenic
1038823689 8:30977583-30977605 AATCATGGCAGAAGGTGAACGGG + Intergenic
1039188420 8:34944084-34944106 AAGAATCTCAAAAGGTCAACTGG + Intergenic
1040680333 8:49801271-49801293 AACAGTGACAGAAGGTGAAGTGG - Intergenic
1041020385 8:53632731-53632753 AATCATGACAAAAGGTGAAGGGG + Intergenic
1041105686 8:54441586-54441608 AAAAAAAACAAAAAGTGAACTGG + Intergenic
1041621838 8:59979636-59979658 AAGAATGACACAAAGAGAAAAGG + Intergenic
1041875191 8:62679616-62679638 AATCATGACAGAAGGTGAAGGGG + Intronic
1041893328 8:62896220-62896242 AAGAGAGACAAAAGGAGACCAGG + Intronic
1042105282 8:65319766-65319788 ATGAAGGACAAATGGTGAAGAGG + Intergenic
1042492540 8:69416413-69416435 AACAAATACAAAAAGTGAACTGG - Intergenic
1042501777 8:69516296-69516318 CAGAATGGCAGAAGGTGAAGGGG + Intronic
1043092115 8:75917937-75917959 AATCATGACAAAAGGTAAAGCGG - Intergenic
1044858333 8:96497562-96497584 AAGGATTTCAAAAGGTGAACTGG + Intronic
1044985645 8:97754252-97754274 AAGAAGGACATAAGGTCAAGAGG + Intergenic
1045358614 8:101411814-101411836 GAGAATGACAGAAGAGGAACAGG - Intergenic
1045420875 8:102013761-102013783 AGGAAAGACAAAAGGAGAGCAGG + Intronic
1045551525 8:103177129-103177151 AAGAGTGAGAAAAGGAGAAAAGG - Intronic
1045559098 8:103243827-103243849 AATCATGGCAGAAGGTGAACAGG + Intergenic
1045772279 8:105756923-105756945 CAGAATGACAGAATGGGAACAGG + Intronic
1045962757 8:107987974-107987996 TAAAATGACAAAAGGTAAGCAGG - Intronic
1046025462 8:108717822-108717844 AAGAATGAGAGGTGGTGAACTGG + Intronic
1046420421 8:113975582-113975604 AAGAAAGATAAGAGGTAAACAGG - Intergenic
1046612093 8:116437326-116437348 AGAAATAACAAAAGGTGAAGAGG + Intergenic
1046914118 8:119661377-119661399 AAGATATACAAAAGGTCAACAGG + Intronic
1046919243 8:119710184-119710206 AAAAAAAAAAAAAGGTGAACTGG - Intergenic
1047283483 8:123465972-123465994 CAGAATGACAAACTGTGAATGGG - Intronic
1048262789 8:132959825-132959847 AACAACAACAAAAGGTGGACTGG - Intronic
1048502499 8:134991292-134991314 AATAATTACAAAAGGAGAAATGG - Intergenic
1048621894 8:136142836-136142858 AAGAATGACAAAGGTAGAAAAGG + Intergenic
1050327290 9:4509693-4509715 AAGAAAGACAGAGGGTGAATCGG + Intronic
1050444016 9:5698924-5698946 AAGAATGACAAAACTTTAAGAGG + Intronic
1051493570 9:17694257-17694279 AACCATGGCAGAAGGTGAACCGG + Intronic
1051701452 9:19828708-19828730 AGGAATTACAAAAAGTGAACAGG + Intergenic
1051840126 9:21386786-21386808 AAGAAATACAAAATGTGAACAGG - Intergenic
1052210540 9:25897838-25897860 GAGAAGGAAAAAAGGTGAAAGGG + Intergenic
1052262461 9:26533280-26533302 AAGACATACAAATGGTGAACAGG + Intergenic
1052395344 9:27931537-27931559 AATCATGGCAAAAGGTGAAGGGG + Intergenic
1052511926 9:29433231-29433253 AATCATGACAGAAGGTGAAAGGG + Intergenic
1052599206 9:30601793-30601815 AAGACATACAAAAGGTTAACAGG - Intergenic
1053089313 9:35259326-35259348 AAGAATAATAACAGGTAAACAGG - Intronic
1055050788 9:71978403-71978425 AAAAATGAAAAAAAGTGACCGGG - Intronic
1055231905 9:74076639-74076661 AATCATGACAGAAGGTGAAGGGG + Intergenic
1055281343 9:74678040-74678062 AAGAATGGCGAAAGTTGAAAAGG + Intronic
1055522998 9:77100946-77100968 AATCATGACAGAAGGTGAAGGGG - Intergenic
1056222815 9:84466969-84466991 AAGCCTAAAAAAAGGTGAACTGG + Intergenic
1057332115 9:94125184-94125206 AAGAAAAAGAAAAGGTGACCAGG + Intergenic
1057364915 9:94410622-94410644 AAAATTGACAGAAGATGAACAGG + Intronic
1058534255 9:105939762-105939784 AAGAATAAGAAAAGGTTGACAGG - Intergenic
1061276910 9:129574211-129574233 AATCATGACAGAAGGTGAAGGGG + Intergenic
1061659489 9:132119392-132119414 AATCATGGCAAAAGGTGAAGGGG - Intergenic
1061903821 9:133686373-133686395 AAGGATGACAAAGGGTTAAGTGG - Intronic
1185559166 X:1045377-1045399 AAGCATGGCAAAAGAGGAACAGG + Intergenic
1186093864 X:6079024-6079046 AATCATGGCAAAAGGTGAAAGGG - Intronic
1186513006 X:10144816-10144838 AAGAATGACACAAGATAAATGGG - Intergenic
1186541168 X:10402013-10402035 AATAATGGCAGAAGGTGAAGGGG + Intergenic
1187143634 X:16617917-16617939 AATAATGACAATACGAGAACTGG - Intronic
1188264732 X:28058566-28058588 AAGAAAGACACAAGGTAAAGAGG - Intergenic
1188408817 X:29845830-29845852 CAGAAAGGCAAAAGGTGAGCAGG + Intronic
1188822238 X:34789643-34789665 AATCATGACAGAAGGTGAAGGGG - Intergenic
1190506990 X:51136160-51136182 AATCACGGCAAAAGGTGAACAGG + Intergenic
1190899408 X:54655115-54655137 AAGAAATCCAAAAGCTGAACAGG + Intergenic
1191741270 X:64437756-64437778 AAGAAACAGAAAAGGTAAACAGG + Intergenic
1191873477 X:65770096-65770118 AATCATGGCAAAAGGTGAAGAGG - Intergenic
1192062402 X:67841587-67841609 AAGACATACAAAAGGCGAACAGG + Intergenic
1192724799 X:73737880-73737902 AAGAAATAGAAAACGTGAACAGG - Intergenic
1192769127 X:74168748-74168770 AATCATGGCAAAAGGTGAAGGGG - Intergenic
1193307612 X:79968052-79968074 AATAATGGCAGAAGGTGAAGGGG + Intergenic
1193489579 X:82133104-82133126 AATCATGACAGAAGGTGAAGGGG + Intergenic
1193667421 X:84338929-84338951 AATAATGGCAGAAGGTGAAAGGG - Intronic
1193683219 X:84547171-84547193 AAGACATACAAATGGTGAACAGG - Intergenic
1194009670 X:88545635-88545657 AAGACATACAAATGGTGAACAGG + Intergenic
1194087948 X:89552206-89552228 AATCATGGCAGAAGGTGAACGGG + Intergenic
1194878206 X:99216455-99216477 AAACATGATAAGAGGTGAACAGG - Intergenic
1194895449 X:99433892-99433914 AATCATGACAGAAGGTGAAGGGG + Intergenic
1195807471 X:108791870-108791892 AGGAATGAAAAAAGGTAAAAAGG - Intergenic
1196048356 X:111279627-111279649 ATGACTGAAAAAAAGTGAACAGG + Intergenic
1196059417 X:111391289-111391311 AATCATGACAGAAGGTGAAGAGG - Intronic
1196385413 X:115143432-115143454 AAGAAATCCAAAATGTGAACAGG + Intronic
1196864633 X:120059622-120059644 AATCATGGCAAAAGGTGAAGGGG + Intergenic
1196878468 X:120176709-120176731 AATCATGGCAAAAGGTGAAGGGG - Intergenic
1197508332 X:127337187-127337209 AAGACATACAAATGGTGAACAGG - Intergenic
1197524894 X:127548620-127548642 AATCATGGCAGAAGGTGAACAGG - Intergenic
1197673429 X:129303660-129303682 AATAATGGCAGAAGGTGAAGGGG - Intergenic
1198007484 X:132511670-132511692 AAGAAATAGAAAAGGTCAACAGG + Intergenic
1198706217 X:139451290-139451312 AAGAATGGGAAAAGATGAATTGG + Intergenic
1198847229 X:140925051-140925073 AATCATGACAGAAGGTGAAGGGG - Intergenic
1199200768 X:145086826-145086848 AATCATGATAAAAGGTGAAGGGG - Intergenic
1200232777 X:154452568-154452590 AAGAAAGAAAAAAGGTGAGCTGG + Intergenic
1200440672 Y:3208595-3208617 AATCATGGCAGAAGGTGAACGGG - Intergenic
1201327774 Y:12783239-12783261 AAGCATGCCAAAAGCTGAAATGG - Intronic