ID: 925080612

View in Genome Browser
Species Human (GRCh38)
Location 2:1061239-1061261
Sequence GCGTCCAACCCAGGATCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080612_925080619 28 Left 925080612 2:1061239-1061261 CCGTGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 925080619 2:1061290-1061312 TTTAAGGCAATTAACAAAAATGG 0: 1
1: 0
2: 2
3: 51
4: 558
925080612_925080618 12 Left 925080612 2:1061239-1061261 CCGTGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 925080618 2:1061274-1061296 AATGATGATAAACATTTTTAAGG 0: 1
1: 0
2: 5
3: 74
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080612 Original CRISPR GCGTCCAACCCAGGATCACA CGG (reversed) Intronic
900210235 1:1451952-1451974 GCGTCCGCCCCAGGACCGCAGGG - Intronic
900865808 1:5267908-5267930 GCCTCCCACACAGGATCCCAGGG + Intergenic
900955006 1:5881295-5881317 CCGTCCAACCCAGGTTCTCCTGG + Intronic
912214584 1:107593522-107593544 CTGTCCAACCCAGTATCCCAAGG + Intronic
918472068 1:184885005-184885027 GCCTCCTACCCAACATCACAGGG + Intronic
918650992 1:186962920-186962942 GATTCCAAGCCAGGTTCACAAGG - Intronic
922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG + Intergenic
924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG + Intergenic
1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG + Intergenic
1075081923 10:119390057-119390079 GCATCCAACCAAGGATCTAAAGG - Intronic
1075587084 10:123666074-123666096 GCCTGCAACCCAGGATCCCGGGG + Intergenic
1077729836 11:4718660-4718682 GCTTCCAGCCCAGGAACACCAGG - Intronic
1078057115 11:8018052-8018074 GCATCCAGCCCACAATCACAGGG - Intergenic
1078414054 11:11150680-11150702 GCTTGCAACCCTGTATCACAGGG + Intergenic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1084350552 11:68595883-68595905 GCCTCCACCACAGGAACACATGG - Intronic
1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG + Intergenic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1097789191 12:63796071-63796093 GTTTCCAATCCAGAATCACACGG + Intronic
1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG + Intergenic
1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG + Intergenic
1106002377 13:25736386-25736408 GATTCCTACCCAGGAACACAGGG - Intronic
1113237668 13:108298737-108298759 GAGGCCAAGGCAGGATCACAAGG + Intronic
1115361552 14:32509054-32509076 GAGGCCAAGGCAGGATCACAAGG - Intronic
1116774683 14:49166206-49166228 GCGTGCAACCCAAGATGACCAGG + Intergenic
1116866318 14:50034597-50034619 GTGTCCAACACAGGATCGCATGG + Intergenic
1119676491 14:76559554-76559576 GGGTCCAATCCAGGATAACCTGG - Intergenic
1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG + Intergenic
1122088779 14:99324390-99324412 TCGTCCAACACAGAATCACCAGG - Intergenic
1124018157 15:25895941-25895963 GCGTCCAAGTCAGACTCACATGG + Intergenic
1132289296 15:100688340-100688362 GTGTCCCACCCAGGACCCCAGGG + Intergenic
1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG + Intergenic
1134759156 16:16698240-16698262 TCTTCCAACCCAGGGGCACAGGG - Intergenic
1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG + Intergenic
1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG + Intergenic
1138607342 16:58097513-58097535 GGGTCCAACCCGGCAGCACAGGG - Intergenic
1140289251 16:73635616-73635638 GCTTTGAAACCAGGATCACAGGG - Intergenic
1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG + Intergenic
1142428625 16:90013910-90013932 CCGCCCCACCCAGTATCACACGG - Intronic
1152118363 17:78402817-78402839 GCATCCAACTCAGGAAGACAGGG - Intronic
1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG + Intergenic
1162440370 19:10688606-10688628 TCCTACAACCCAGGGTCACACGG + Exonic
1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG + Intergenic
925027451 2:621084-621106 GCTTCCATCCCCGGAGCACAGGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925148109 2:1594544-1594566 GCTTCCAGCCCAGGAGCACTGGG - Intergenic
934216731 2:90038019-90038041 CCATCCACCCCAGGATCTCAGGG - Intergenic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG + Intronic
945419940 2:209622408-209622430 GTGTCCTTCCCAGCATCACAAGG - Intronic
1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG + Intergenic
1178003846 21:28194323-28194345 GCACCCAACCCTGGAGCACATGG + Intergenic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1180222222 21:46366201-46366223 GCATCCAACCAAGAATCCCAAGG - Intronic
1181565713 22:23735993-23736015 CCGTACTACTCAGGATCACATGG - Intergenic
950145345 3:10645958-10645980 GGGTCCCACCCAGGATCAAGTGG - Intronic
955753939 3:62209019-62209041 GCGCCAAAGCCAGCATCACATGG - Intronic
957879015 3:86185927-86185949 GCATCCAACACTGGAGCACAAGG + Intergenic
961007930 3:123417245-123417267 GCCTCCTGCCCTGGATCACATGG - Intronic
968853224 4:3098492-3098514 GCATCCAAACCAGTAACACAAGG - Intronic
975848051 4:78546210-78546232 GCAGCCACCCCAGAATCACAAGG - Intergenic
977809834 4:101346526-101346548 GCGTCCCACCCAGCCTCACTTGG - Intronic
985802374 5:2013155-2013177 GCGCTCACCCCAGGGTCACAGGG - Intergenic
986707895 5:10466431-10466453 GCGTGCAACACAGCATCACTGGG + Intronic
992758778 5:79933477-79933499 GCTTCCAACTCAGGACCAAACGG + Intergenic
998058670 5:139101703-139101725 GTGTCTAACCCAGAATCAAATGG - Intronic
998747607 5:145278708-145278730 GGGTCCATCCAAGGAACACAAGG + Intergenic
1005412828 6:25568386-25568408 GCGCCCAGCCTAGGACCACATGG + Intronic
1007913680 6:45540684-45540706 GCGATTAACCCAGGATCATAAGG + Intronic
1016417746 6:143850931-143850953 GCACCAAACCCAGCATCACAGGG + Intronic
1018896834 6:168025278-168025300 GCCTCCAACCGAGGGACACAGGG - Intronic
1023532760 7:41175509-41175531 GCATCCCAGCCAGGATGACACGG - Intergenic
1027129525 7:75581198-75581220 CCGTCTAACCCAGGCTCTCATGG - Intronic
1029104527 7:98164637-98164659 GAGTCCTAACCAGGATCACTGGG + Intronic
1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG + Intronic
1029715449 7:102322965-102322987 GCCTCCCACCCAGGATTACTCGG - Intergenic
1033435324 7:141328531-141328553 GGGTCTAACCCAGGAACAGAAGG + Intronic
1042338720 8:67656522-67656544 GCTCACAACCCAGCATCACATGG - Intronic
1043026939 8:75082099-75082121 GAGTGCATCCCAGGATCACATGG + Intergenic
1048468448 8:134686335-134686357 GCCCCCAACCCAGGATAACCAGG - Intronic
1048557830 8:135498018-135498040 GCCACCAACCTAGGTTCACAGGG - Intronic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1049786391 8:144452926-144452948 GTGTCCAACGCAGGACCTCAGGG - Intronic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1053020658 9:34691707-34691729 GAGGCCACCCCAGGATCTCATGG - Intergenic
1057016578 9:91657657-91657679 ACGTCCCACCCAGCAGCACAGGG + Intronic
1059331473 9:113538334-113538356 GTGACCAACCCAGGATCAGTGGG - Intronic
1060479946 9:124012092-124012114 GCGCCAAAGCCAGGGTCACAAGG - Exonic
1061059903 9:128245090-128245112 GTGTCCAACCCCGAAGCACAGGG + Intronic
1061899158 9:133664194-133664216 ATGTCCAACTCAAGATCACATGG - Intronic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG + Intergenic
1199962345 X:152788556-152788578 GCTGCCAACCCAGGACCACCCGG - Intergenic
1200138826 X:153887259-153887281 GCATCCAAGCCAGGATGCCAGGG - Intronic