ID: 925080612 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:1061239-1061261 |
Sequence | GCGTCCAACCCAGGATCACA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 96 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 6, 4: 88} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925080612_925080619 | 28 | Left | 925080612 | 2:1061239-1061261 | CCGTGTGATCCTGGGTTGGACGC | 0: 1 1: 1 2: 0 3: 6 4: 88 |
||
Right | 925080619 | 2:1061290-1061312 | TTTAAGGCAATTAACAAAAATGG | 0: 1 1: 0 2: 2 3: 51 4: 558 |
||||
925080612_925080618 | 12 | Left | 925080612 | 2:1061239-1061261 | CCGTGTGATCCTGGGTTGGACGC | 0: 1 1: 1 2: 0 3: 6 4: 88 |
||
Right | 925080618 | 2:1061274-1061296 | AATGATGATAAACATTTTTAAGG | 0: 1 1: 0 2: 5 3: 74 4: 694 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925080612 | Original CRISPR | GCGTCCAACCCAGGATCACA CGG (reversed) | Intronic | ||