ID: 925080612

View in Genome Browser
Species Human (GRCh38)
Location 2:1061239-1061261
Sequence GCGTCCAACCCAGGATCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080612_925080619 28 Left 925080612 2:1061239-1061261 CCGTGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 925080619 2:1061290-1061312 TTTAAGGCAATTAACAAAAATGG 0: 1
1: 0
2: 2
3: 51
4: 558
925080612_925080618 12 Left 925080612 2:1061239-1061261 CCGTGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 925080618 2:1061274-1061296 AATGATGATAAACATTTTTAAGG 0: 1
1: 0
2: 5
3: 74
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080612 Original CRISPR GCGTCCAACCCAGGATCACA CGG (reversed) Intronic