ID: 925080618

View in Genome Browser
Species Human (GRCh38)
Location 2:1061274-1061296
Sequence AATGATGATAAACATTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 694}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080612_925080618 12 Left 925080612 2:1061239-1061261 CCGTGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 925080618 2:1061274-1061296 AATGATGATAAACATTTTTAAGG 0: 1
1: 0
2: 5
3: 74
4: 694
925080617_925080618 3 Left 925080617 2:1061248-1061270 CCTGGGTTGGACGCTGGGGTGGA 0: 1
1: 1
2: 0
3: 10
4: 188
Right 925080618 2:1061274-1061296 AATGATGATAAACATTTTTAAGG 0: 1
1: 0
2: 5
3: 74
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080618 Original CRISPR AATGATGATAAACATTTTTA AGG Intronic
901567314 1:10128822-10128844 AACGATGAAAAACACTTTTTAGG - Intronic
902072546 1:13752843-13752865 TATGATGATATTCATTTTTAAGG - Intronic
902350654 1:15851554-15851576 AAAGATGTTAAATATTTTAAGGG - Intronic
902953991 1:19912017-19912039 AAGGATGCTAAACATTTTCATGG - Exonic
904045593 1:27606382-27606404 AGTGATGATCAACACTTTAAGGG - Intergenic
904439272 1:30519391-30519413 AATGATGATGAACATGATGATGG + Intergenic
904560435 1:31393732-31393754 TATGATGATATATATTTTTTGGG + Intergenic
904966107 1:34374336-34374358 CAAGATTATAAATATTTTTAAGG + Intergenic
906325866 1:44845263-44845285 AAAGAGTATGAACATTTTTATGG + Intergenic
906397452 1:45479134-45479156 AAGGATGTTAAAAATTTTTTTGG - Intronic
907120089 1:52000775-52000797 GATGGTGATAACCATATTTAAGG + Intergenic
907172494 1:52482077-52482099 AATGATCATCAACATTTTAATGG - Intronic
907476264 1:54707761-54707783 AATGATTATTAACCTTTTTTGGG + Intronic
908159846 1:61395898-61395920 AATGATTTTAAAAATGTTTATGG - Intronic
908172800 1:61524321-61524343 AATGTTGACAAGCATTTGTAAGG - Intergenic
908429461 1:64041860-64041882 AATGAAGATAAACATTTTCTGGG - Intronic
909442068 1:75708111-75708133 GCTGAGAATAAACATTTTTAAGG - Intergenic
909782510 1:79563995-79564017 GATGATGATAAACAAGGTTAAGG + Intergenic
910162065 1:84283897-84283919 AGATATGATAGACATTTTTATGG + Intergenic
910408833 1:86918023-86918045 AATGATAATAACTACTTTTAAGG - Intronic
910570385 1:88694879-88694901 AATGTTTAAAAACATTTTGAAGG + Intronic
910869975 1:91824519-91824541 AATGAAAATAAACATTTGAATGG - Intronic
910997546 1:93124288-93124310 AACCATGATAAACTTTCTTAAGG + Intronic
911281243 1:95931944-95931966 ACTTATGAAAAACATTTCTAAGG + Intergenic
911448548 1:98033643-98033665 AATTAGTAGAAACATTTTTAGGG - Intergenic
911611739 1:99966023-99966045 TATGTTGATAGACATTTTTAAGG - Intergenic
911637516 1:100251200-100251222 AATGTCTATAAACATTTTTAAGG - Intergenic
911810811 1:102277293-102277315 AATTATGATAAAAATTTCTATGG - Intergenic
912673653 1:111655639-111655661 AAAGACTATGAACATTTTTAAGG - Intronic
913037913 1:114991227-114991249 ATTGATGTTAATTATTTTTAAGG - Intronic
913204351 1:116522835-116522857 CTTCATGATAAATATTTTTAAGG - Intronic
913591774 1:120335958-120335980 AAAACTGACAAACATTTTTAAGG + Intergenic
913651581 1:120919187-120919209 AAAACTGACAAACATTTTTAAGG - Intergenic
914405877 1:147372012-147372034 AATGCTGCTAAAAATGTTTATGG - Intergenic
916455924 1:164970945-164970967 AATGATGATGAAGATGTTAATGG + Intergenic
916459733 1:165011071-165011093 AATGATGCCAAACATTTGGATGG - Intergenic
917149861 1:171931927-171931949 AAAAATAATAAATATTTTTAAGG - Intronic
917329302 1:173865569-173865591 AATGATGTTTAGCATTTTAATGG - Intergenic
917569150 1:176246352-176246374 AAGGGTGATAAATAATTTTAGGG + Intergenic
918515012 1:185353786-185353808 AAGGAAGATAAATATGTTTATGG + Intergenic
918639990 1:186827966-186827988 ATTTATAATAAACATTTTTCGGG - Intergenic
918815495 1:189175233-189175255 AATCATGAGAAACATTGTTCAGG - Intergenic
918913324 1:190602331-190602353 AATGAAGATCAATATTTTAAAGG + Intergenic
919117893 1:193304203-193304225 CATTTTGATAAACACTTTTAAGG - Intergenic
919233322 1:194804751-194804773 TTTGATGATAGCCATTTTTATGG + Intergenic
920176764 1:204106843-204106865 AATTGTGATAAATACTTTTAAGG + Intronic
920755785 1:208730166-208730188 AATTGTCATAAAAATTTTTAAGG + Intergenic
920996312 1:210995978-210996000 ATTGATGATTAAGATTTTTGAGG + Intronic
921234509 1:213111966-213111988 AAAGAGAATAATCATTTTTAAGG + Intronic
921291883 1:213665414-213665436 AATGAAGTTGAACATTTTAATGG - Intergenic
921484685 1:215702243-215702265 AATGATGAAAAAAATGTTAAGGG - Intronic
921606182 1:217158135-217158157 AAAGATGCTAATCAATTTTATGG - Intergenic
921705740 1:218321139-218321161 AAAGCTGATTAACATTTTTAAGG + Intronic
922004786 1:221519070-221519092 GATGGTGATAATCAATTTTAAGG + Intergenic
922904893 1:229166654-229166676 AATGAGCAGAAACATTTTCACGG + Intergenic
923118729 1:230970048-230970070 AATGTTAATGAACATGTTTAAGG + Intronic
923166454 1:231368398-231368420 AATTATGCTAAGAATTTTTAAGG + Intronic
923482866 1:234400671-234400693 AATCATAATAAGCATGTTTATGG + Intronic
923771114 1:236938217-236938239 AATGATTATAAACACTTCCATGG + Intergenic
924365743 1:243291587-243291609 ACTGAAGATAAATATTTTTCTGG + Intronic
1063249745 10:4261176-4261198 AATGATGATTACTATTTTAATGG - Intergenic
1063444036 10:6097295-6097317 AATGGTGTTAAGCATTTGTAGGG + Intronic
1063482908 10:6392157-6392179 AGTTATGAAAAACACTTTTAAGG - Intergenic
1063789857 10:9430947-9430969 AATAAATATAAACATTTTTGTGG - Intergenic
1063996821 10:11627451-11627473 AATGATAATAATAATATTTAGGG - Intergenic
1064708102 10:18093841-18093863 AATCATGAAAAACATTTTAATGG + Intergenic
1064774699 10:18763490-18763512 AATGATAATACTCAATTTTAAGG + Intergenic
1065044608 10:21736105-21736127 AATAATGATTTACATTTTAAAGG + Intronic
1065166861 10:22988616-22988638 AATGATGATGGTCATTTTGAAGG + Intronic
1066086274 10:31974808-31974830 AATAATGATATACATTTTTATGG - Intergenic
1066284796 10:33954354-33954376 AGTGATAACAAACATTTTTGTGG + Intergenic
1066579916 10:36869428-36869450 TATGATGATTAACATCTTTGAGG + Intergenic
1066699051 10:38107071-38107093 AATGAAGGAAAACATTTTAAGGG + Intronic
1067363899 10:45607265-45607287 AATTTTGATAAATATTTTAAAGG - Intergenic
1067382103 10:45784110-45784132 CATAATGAGAAACATTTTGAAGG - Intronic
1067889799 10:50124752-50124774 CATAATGAGAAACATTTTGAAGG - Intronic
1068052593 10:51969280-51969302 GATGATGATTAAGATTTCTAGGG - Intronic
1068053030 10:51976346-51976368 AATCATGATAGACATTTGCATGG - Intronic
1068451802 10:57199694-57199716 AATTATGATAGACATTTCTAAGG + Intergenic
1068715630 10:60184873-60184895 AATGATGAAATACAATATTATGG + Intronic
1068724704 10:60288348-60288370 ATGGATGATAATCTTTTTTAGGG + Intronic
1068954350 10:62808423-62808445 AATGATATTAATCACTTTTATGG + Exonic
1069068567 10:63972133-63972155 AATCTTGTTAAAGATTTTTATGG - Intergenic
1069204002 10:65658981-65659003 AATTATTATAACCATTTTTGTGG - Intergenic
1070040850 10:72778189-72778211 AAAGATAATCAATATTTTTAAGG + Intronic
1070049155 10:72870203-72870225 AATGATGAAAATTATTTTTCAGG - Intronic
1070095305 10:73331820-73331842 AATGATTATGGATATTTTTAAGG - Intronic
1070204977 10:74248910-74248932 AAGGATGATAAACATTAGAAAGG + Intronic
1070294383 10:75146840-75146862 AAAGATGATAAAAAGCTTTAGGG - Intronic
1070941549 10:80352934-80352956 GATGATGATACCCATTTTTCAGG - Intronic
1070941661 10:80353749-80353771 GATGATGATACCCATTTTTCAGG + Intronic
1071441440 10:85700884-85700906 AGTAATGATGAACATTTATATGG + Intronic
1071815724 10:89230724-89230746 AATGATAATACACATTTTATAGG + Intronic
1072092738 10:92145260-92145282 AATGATGATAAAAAGTTATCTGG - Intronic
1073142361 10:101256636-101256658 AAGGATGATAACTATTGTTATGG + Intergenic
1074686367 10:115965728-115965750 AAGGATAAGAATCATTTTTAAGG - Intergenic
1078039963 11:7851108-7851130 GAGGAAAATAAACATTTTTATGG - Intergenic
1078505519 11:11939159-11939181 AAGGATGATAATCATTTGTCTGG - Intronic
1078903680 11:15664728-15664750 TATGATATTAGACATTTTTAGGG + Intergenic
1079496920 11:21054905-21054927 CAAGATGATAAAGATTTTAAGGG - Intronic
1079604809 11:22351804-22351826 AATGATGAACATCATTTTCAGGG + Intronic
1079851274 11:25538593-25538615 ACTGATGATAACCTTTATTAAGG + Intergenic
1080112730 11:28586890-28586912 AATGATGATGAAATTTTTTAAGG + Intergenic
1080506309 11:32917396-32917418 AATGATGTTTAACTTTTTGAGGG + Intronic
1080602902 11:33837652-33837674 AATAATGTTACACAGTTTTAAGG + Intergenic
1080890799 11:36407603-36407625 AATGGTAATAAACTTTTTGATGG + Intronic
1081247308 11:40784165-40784187 CATGAAGGTAAACATTTTGAAGG - Intronic
1082888711 11:58115179-58115201 AATTATGATAAATATTTTTGTGG - Intronic
1082999746 11:59280480-59280502 AATGATGATAAAGAAATTTGGGG + Intergenic
1083743172 11:64721862-64721884 AATAATGAAATAGATTTTTAGGG - Intronic
1084504994 11:69560127-69560149 AATTAAGATATACATTTTTTAGG - Intergenic
1084645181 11:70452667-70452689 ATTGATGATACTCATCTTTAAGG + Intergenic
1086025888 11:82290805-82290827 AATAATGATACATATTTATAGGG + Intergenic
1086586147 11:88454816-88454838 AGTGATGAAAAATATTTTTGTGG - Intergenic
1086761077 11:90632134-90632156 AATGATGATTAACATATTAAAGG - Intergenic
1086824908 11:91484733-91484755 AATGATGGTGAATATTTTGATGG + Intergenic
1086943705 11:92824054-92824076 AAGTATGAAAATCATTTTTAAGG + Intronic
1087358621 11:97128353-97128375 AATAATCATACACATTTATAGGG + Intergenic
1088148824 11:106718850-106718872 AAGGATGAAAAACATATTTAAGG + Intronic
1088601305 11:111478550-111478572 AATTATGACAAAGATTTTAAAGG + Intronic
1090321346 11:125846194-125846216 AATGAAGAAAAAGATTTTAAGGG + Intergenic
1091089442 11:132756613-132756635 TATAATGATAAACATATTTATGG + Intronic
1091243770 11:134073733-134073755 AATGATAATAAACATTTTGTTGG + Intronic
1091458608 12:627239-627261 AAGGATGATAAAAATTCTAAAGG - Intronic
1091955884 12:4642286-4642308 AATTAAGCTAAAAATTTTTAGGG - Intronic
1092623809 12:10303646-10303668 AACAAAGATAAATATTTTTAGGG + Intergenic
1093426926 12:19038180-19038202 AATGATGAGGCACATTTTGAAGG + Intergenic
1093562081 12:20553125-20553147 AAGGAAGACAAACCTTTTTAGGG - Intronic
1096364062 12:51013527-51013549 AATGATGATTAATATCATTAAGG + Intronic
1096658787 12:53108861-53108883 ATGGATGACAAACAGTTTTAGGG + Intronic
1097516224 12:60610313-60610335 CATAATGATGAACATTTTCATGG - Intergenic
1097871766 12:64608280-64608302 AATGAAAAAAATCATTTTTATGG + Intergenic
1098576645 12:72050266-72050288 AATGGGGATAAAAATTTTCAGGG + Intronic
1099153815 12:79149491-79149513 TATGATGCTAAACATTGTTAGGG - Intronic
1099427122 12:82537032-82537054 AATGTAAATAAGCATTTTTAAGG + Intergenic
1099478470 12:83138175-83138197 AATGATGATAAATATCATCAAGG - Intergenic
1100485943 12:95027403-95027425 AAGGATGTTAGACATTTATATGG - Intronic
1100910641 12:99357763-99357785 AAAGAGTATAAACATTTTTGAGG + Intronic
1101835206 12:108290172-108290194 AATGAGGATGAACATCTTAATGG - Exonic
1101971531 12:109316804-109316826 GATGATGAAACACATTCTTAGGG - Intergenic
1103102334 12:118189403-118189425 AATAATGCTAAATTTTTTTAAGG - Intronic
1103183464 12:118935492-118935514 AATGATGATTAGCATATTAAAGG - Intergenic
1105386480 13:19934562-19934584 GATAATGATAAAAATTTTAAAGG - Intergenic
1105422550 13:20265992-20266014 AATGACAATGAACATTTTTGGGG + Intergenic
1105440470 13:20411177-20411199 AAGAATGATAAACATTTCTATGG + Intronic
1105531282 13:21222715-21222737 AATAATTAAAGACATTTTTAAGG + Intergenic
1105677782 13:22692042-22692064 ATTGTTGATAAACCTTTTTAGGG + Intergenic
1105960045 13:25325216-25325238 AATGGAGATAAACCTTTTTAGGG - Intronic
1106067882 13:26374880-26374902 AAAGAATATAAACATTTTTAAGG - Intronic
1106235863 13:27859709-27859731 AATAATGAGAAAAATGTTTAAGG + Intergenic
1106507033 13:30380024-30380046 AATGATGCTCAACATCATTAGGG + Intergenic
1106914519 13:34498336-34498358 AGTGATGATGAGCATTTTTTCGG - Intergenic
1107183426 13:37488719-37488741 AAGGAAGTTAAACATTTCTATGG + Intergenic
1107555593 13:41514805-41514827 ACTGAGGATAAACATCTTTCTGG + Intergenic
1107946618 13:45422475-45422497 TATAATGATAAAGAATTTTATGG - Intergenic
1109106426 13:58257061-58257083 AAAGAAGATAAACATTTTAAAGG + Intergenic
1109457283 13:62609915-62609937 AATGAAGATAAAAATGTTAAGGG - Intergenic
1109799338 13:67355816-67355838 AATGATGAAAAGCATGTTTTAGG + Intergenic
1110198761 13:72823417-72823439 AAGCATGATAAGCATCTTTATGG + Intronic
1110548532 13:76784241-76784263 AAAGAATATAAACATTTTTAAGG - Intergenic
1110909381 13:80936672-80936694 AATATTGATATACATATTTATGG + Intergenic
1111400378 13:87725948-87725970 AATAATGAACAACATTTTTCAGG + Intergenic
1111598214 13:90437864-90437886 AATTATGATTAATATGTTTAGGG - Intergenic
1111681064 13:91442075-91442097 AATAATAAAAAATATTTTTAAGG - Intronic
1112303933 13:98256202-98256224 AATGTTGATAAACATTTGTTAGG + Intronic
1112347713 13:98604736-98604758 AATGTAGGTAAAGATTTTTAAGG + Intergenic
1112347956 13:98607990-98608012 AATGTAGGTAAAGATTTTTAAGG - Intergenic
1112643234 13:101300854-101300876 AAAGTTTATAAATATTTTTAAGG - Intronic
1112663975 13:101546414-101546436 AATGAAAATGAACATTTTAAGGG + Intronic
1112714458 13:102167825-102167847 AAAGATGCTAAACATATTTAAGG + Intronic
1112786439 13:102956804-102956826 AAGGATGCCAAACATTTTCAAGG + Intergenic
1113001814 13:105648037-105648059 AATGATGATATAAATTATTGGGG + Intergenic
1113015640 13:105825366-105825388 ATTGATGATAAACATCTTAAGGG + Intergenic
1113077743 13:106484621-106484643 AAAGATGAAAAACATTTTCCAGG - Intergenic
1113238018 13:108303226-108303248 AATGAAGAGAATCATTTATAAGG - Intronic
1113815361 13:113166268-113166290 AATGAATATAAACATTATTGAGG + Intronic
1114130803 14:19789349-19789371 AATGATAATAAACAAACTTAGGG + Intronic
1114836941 14:26213647-26213669 AAATCTGAGAAACATTTTTAAGG - Intergenic
1115362450 14:32518912-32518934 AATGAAGAAAAACATGTTAAGGG + Intronic
1115425979 14:33259594-33259616 AATGCTGAAAAATATTTTGAGGG + Intronic
1115494976 14:33994668-33994690 AAGGAGTATAAATATTTTTATGG - Intronic
1115610572 14:35045449-35045471 TATGATGAAAAACATTTACAAGG + Intronic
1116046175 14:39745852-39745874 AATAATTTTAAACTTTTTTATGG - Intergenic
1116302679 14:43205229-43205251 AATTATGATTAATATTTTAAAGG + Intergenic
1116443615 14:44982830-44982852 AATGATGGTAAACAGTATGATGG + Intronic
1116567693 14:46471196-46471218 AATGATGGTAATTATTTTGAGGG - Intergenic
1116894898 14:50306537-50306559 AAGGATGAGAAGCATTATTATGG - Intronic
1117526849 14:56616741-56616763 AATGATTATTAATATTTTTAAGG + Intronic
1117855905 14:60033044-60033066 AAAGATGATTAAAATCTTTATGG - Intronic
1117867300 14:60163310-60163332 TTTGCTGAAAAACATTTTTATGG + Intronic
1118136120 14:63030204-63030226 AATGTTTGTAAACATCTTTAAGG - Intronic
1118271695 14:64349163-64349185 AATGATGATAAAAATATACATGG + Intergenic
1118281914 14:64437088-64437110 AAGGAGGAGAAGCATTTTTAAGG - Intronic
1118923105 14:70167877-70167899 AATGATGATGAACATGTTGAAGG + Exonic
1119015784 14:71052912-71052934 ATGGAGCATAAACATTTTTAAGG + Intronic
1119068686 14:71558135-71558157 AGTAAATATAAACATTTTTAGGG + Intronic
1119118623 14:72051862-72051884 AAAAATGAAAAACATTTTTATGG + Intronic
1120341033 14:83221233-83221255 AGTGATGATGAGCATTTTTCTGG - Intergenic
1120353454 14:83394888-83394910 AATGATGATTAACCTTATTGAGG - Intergenic
1120561932 14:86005488-86005510 AATAATGATGATGATTTTTAAGG - Intergenic
1121183758 14:91948806-91948828 AAAGATTATAAACACCTTTAAGG + Intergenic
1121649367 14:95545877-95545899 AATGATGAGAAACTTATTGATGG + Intergenic
1122015189 14:98789245-98789267 ACTGATCTTAAACACTTTTAAGG - Intergenic
1122146836 14:99695527-99695549 AATAAAGATGAACATTTCTAAGG - Intronic
1123573853 15:21644980-21645002 AATGATAATAAACAAACTTAGGG + Intergenic
1123610471 15:22087565-22087587 AATGATAATAAACAAACTTAGGG + Intergenic
1125026811 15:35038779-35038801 AATCATAATTAACATTTATATGG - Intergenic
1125042415 15:35206226-35206248 AATGATGCCAAACATTTTGGAGG + Intergenic
1125253070 15:37728743-37728765 AATTCTGTTAAACATATTTAGGG + Intergenic
1125705445 15:41731062-41731084 AAGGATGAAAAACATTCTTAAGG + Intronic
1125861853 15:43006660-43006682 AATCATGTTAAACATTTTCTTGG - Intronic
1126393096 15:48180160-48180182 AATCAAGATAAATATTTTAATGG - Intergenic
1126455419 15:48856257-48856279 AGTGATGTTAAACATTTGGATGG + Intronic
1126725826 15:51630945-51630967 AATGAAGATATAAAGTTTTATGG + Intergenic
1127374985 15:58376199-58376221 AATGTTGATGAAGATGTTTAAGG + Intronic
1127585346 15:60372860-60372882 AATTATTAAAAATATTTTTAGGG + Intronic
1128190587 15:65691142-65691164 GATGATGATACACCTTTTGATGG - Exonic
1130145193 15:81268738-81268760 AATGACAAGAAACATTTCTAAGG + Intronic
1131672948 15:94640387-94640409 AATGTTTAAAACCATTTTTATGG - Intergenic
1131704863 15:94982768-94982790 AATGATGAGAAATATTTTGAAGG - Intergenic
1131714770 15:95096414-95096436 GATAATTATAACCATTTTTATGG - Intergenic
1131763182 15:95646393-95646415 AATGAAGTTTAACATTTGTATGG + Intergenic
1202982718 15_KI270727v1_random:379319-379341 AATGATAATAAACAAACTTAGGG + Intergenic
1133513928 16:6488738-6488760 AATGTTGTTAAATATTATTATGG - Intronic
1133830620 16:9320155-9320177 CATGGTGATAAGCATGTTTATGG + Intergenic
1133870172 16:9678543-9678565 AATAATGATAAACTGTTTTCTGG + Intergenic
1134263971 16:12676765-12676787 AATGATGATAATAATATTTATGG + Intronic
1134329014 16:13233419-13233441 AAAGAGTATAAACATTGTTAAGG - Intronic
1134383615 16:13751196-13751218 GATGATTTTAAACATTTCTAAGG - Intergenic
1135221317 16:20616384-20616406 AATTGTGATAGACATTTTTAAGG - Intronic
1138775303 16:59715246-59715268 AATAATGCTAAACATTATAAAGG + Intronic
1139074216 16:63423804-63423826 TATAATCATTAACATTTTTAAGG + Intergenic
1139685232 16:68598140-68598162 AATTATGTTTAACATTTTGAGGG + Intergenic
1139947710 16:70652761-70652783 AAAGAGTATAGACATTTTTAAGG + Intronic
1140157558 16:72448054-72448076 AATGATAATGAAAATCTTTAAGG - Intergenic
1140315532 16:73892883-73892905 AGGGAAGAAAAACATTTTTATGG + Intergenic
1140627961 16:76817475-76817497 AATCATGAAAAACATTTTTTTGG + Intergenic
1140703014 16:77599876-77599898 AATGTTCATAAACACATTTATGG - Intergenic
1140746025 16:77981048-77981070 AATAATGCCAAACATTTATAAGG + Intergenic
1141055399 16:80809216-80809238 AATAATAATAAACATTATTATGG - Intergenic
1143852616 17:9823999-9824021 AGTGATGCTGAAGATTTTTAAGG + Intronic
1144347586 17:14363629-14363651 AATCATGATGAACACTTTTAGGG + Intergenic
1144643648 17:16953731-16953753 AATGCTTTTAAGCATTTTTAAGG - Intronic
1145205098 17:20980348-20980370 AATGCTTTTAAACATTTTTAAGG + Intergenic
1146534220 17:33635910-33635932 TTTGATGATGAACATTTCTATGG - Intronic
1147345802 17:39793944-39793966 AAGAATAATAAACATTTGTAAGG + Intronic
1148186201 17:45645873-45645895 AAGGATAATAAACATGATTATGG - Intergenic
1148523721 17:48308869-48308891 AATAATAACAAACATTTATATGG - Intronic
1149167203 17:53766616-53766638 TATAATGAGAAACAATTTTATGG - Intergenic
1149177483 17:53891168-53891190 AATGATGATAGAGATATATAAGG + Intergenic
1149236059 17:54592454-54592476 AATGAAGAAAAAAATGTTTAGGG - Intergenic
1149508629 17:57217548-57217570 AATGATGATGAACATGCTGAGGG + Intergenic
1149688591 17:58554269-58554291 AATGATGAGCTACATTATTATGG - Intergenic
1149886797 17:60348150-60348172 AAAGATGATAAACTTTTTTAAGG + Intronic
1150471016 17:65437728-65437750 AAAGGGGATGAACATTTTTATGG - Intergenic
1150722155 17:67622477-67622499 AATGATGAAAACCATCTCTATGG - Intronic
1151464190 17:74274065-74274087 AATGATCATGAATATTTGTAGGG - Intergenic
1153165772 18:2260426-2260448 AATTGTAATAAAAATTTTTAAGG + Intergenic
1153251103 18:3122804-3122826 AATTATCAAAAACATTTTTGGGG - Intronic
1153690724 18:7590649-7590671 AATGATGACAAGAATATTTAAGG + Intronic
1153718822 18:7880608-7880630 GGTGCTAATAAACATTTTTAGGG + Intronic
1153944557 18:10007743-10007765 AATGATGGTAAACAAAGTTATGG - Intergenic
1154003721 18:10507399-10507421 AATGAAGAAAAATATTTCTACGG - Intergenic
1155634109 18:27931381-27931403 AATAATGAAAATCATTTTTCTGG - Intergenic
1155849819 18:30759517-30759539 CATAATAATAAACATATTTATGG - Intergenic
1156581671 18:38383977-38383999 AAATATCATAAACATTTCTAAGG - Intergenic
1158534876 18:58298721-58298743 CATGATGACAAACATTTCTGGGG + Intronic
1158610215 18:58933239-58933261 GATTATAATAAACATTTTTTGGG + Intronic
1159328959 18:66963494-66963516 AAGGATAATAAAAATTATTAGGG - Intergenic
1159344782 18:67187410-67187432 AATGACAATGCACATTTTTAAGG - Intergenic
1159386220 18:67728519-67728541 AATGATGATTAATATGTTAAAGG - Intergenic
1159424713 18:68270631-68270653 TATGAATATAAACACTTTTAGGG - Intergenic
1159768852 18:72523933-72523955 AAAAATGATAATAATTTTTATGG - Intergenic
1159866372 18:73710544-73710566 AATGATGAAAAATAATTTTTTGG + Intergenic
1160052213 18:75444592-75444614 ATTGATGTTAAATATATTTATGG + Intergenic
1160137022 18:76281119-76281141 AATGATGTTGAACATATTTTTGG + Intergenic
1160454383 18:78989271-78989293 AAATATGTTAAATATTTTTAGGG - Intronic
1161559081 19:4960917-4960939 AAGGAAGACAAACCTTTTTAGGG - Exonic
1161929212 19:7325035-7325057 AATGATGGTAAACACCTTTTCGG - Intergenic
1162261066 19:9534567-9534589 AATGCTGATAAACAACTTAAAGG + Intronic
1163788108 19:19287829-19287851 ACTGTATATAAACATTTTTAGGG + Intronic
1164930715 19:32173769-32173791 AATGTTGATTCACATTTTAAAGG + Intergenic
1165026468 19:32966222-32966244 AATCGTGGTAAACATTTTGAAGG + Intronic
1165685765 19:37818229-37818251 ACAGATAATAAACATTTTAAAGG - Intergenic
1166551829 19:43670459-43670481 AATGAGGATAAAAACTTTGACGG + Intronic
1166836879 19:45672705-45672727 GATGATGATAAACCCTTATATGG - Intronic
1168646819 19:58064449-58064471 AATGAGGATGAAGATCTTTATGG + Intronic
925080618 2:1061274-1061296 AATGATGATAAACATTTTTAAGG + Intronic
925315915 2:2922949-2922971 AAAAAGGATCAACATTTTTAAGG - Intergenic
926486182 2:13461062-13461084 AATGATCATAAATATGTTAAAGG + Intergenic
926492123 2:13537606-13537628 CATTACAATAAACATTTTTATGG + Intergenic
926543875 2:14214042-14214064 AAGGGAGATACACATTTTTAAGG - Intergenic
927620306 2:24649278-24649300 AATGATCATTTACTTTTTTAAGG + Intronic
927750726 2:25667913-25667935 AATGATAATATTCCTTTTTATGG - Intronic
928061664 2:28119523-28119545 AATGATGATCAAGATTTTGTTGG - Intronic
928389530 2:30898405-30898427 AAGGATGACAAACATTTCTGAGG + Intergenic
928880350 2:36090110-36090132 AATGAAGGAAAACATTTTAAGGG + Intergenic
928885164 2:36140025-36140047 AATGATGATAATGATGATTATGG - Intergenic
928901328 2:36321248-36321270 TATGAGTTTAAACATTTTTATGG - Intergenic
929328214 2:40645114-40645136 AAAAATTAAAAACATTTTTAAGG - Intergenic
930281166 2:49371827-49371849 AATGGTGGTAAATATTATTATGG - Intergenic
930532465 2:52607105-52607127 ACTTATGATTAACATATTTAAGG - Intergenic
930642657 2:53870216-53870238 AATTATGAGAAACCTTTTGAAGG - Intronic
930674510 2:54186399-54186421 AAAGAATATAAACATTTTCAAGG - Intronic
930757008 2:54985642-54985664 AATGATGTTATACAAGTTTAGGG - Intronic
930824194 2:55679562-55679584 AAACATGACAAAAATTTTTATGG + Intronic
930877678 2:56237819-56237841 AATGAAGAGAAAGATATTTATGG + Intronic
930933096 2:56913462-56913484 AATGGTGATAAATATTTTCCAGG + Intergenic
930977552 2:57482109-57482131 AATTATGGTAAAGATTTGTAAGG + Intergenic
931033114 2:58206555-58206577 AATGATTTTAAACATTGTGATGG - Intronic
931307618 2:61046424-61046446 AATGATTATCAGGATTTTTATGG + Intronic
931674894 2:64684658-64684680 AAAGATGTTCAACATTATTAGGG - Intronic
931849727 2:66240110-66240132 AATGAGGATAAAGAATTTCAAGG + Intergenic
932527102 2:72482286-72482308 AAGGAATATGAACATTTTTATGG - Intronic
932900865 2:75698260-75698282 AATCGAGATGAACATTTTTATGG - Intronic
933092730 2:78141733-78141755 ATTAATGATAAACCTTTTAATGG + Intergenic
933145786 2:78851014-78851036 CATGATTATATACATTTTTATGG - Intergenic
933153605 2:78946108-78946130 AAAGATAATCACCATTTTTATGG + Intergenic
933432133 2:82196230-82196252 AATGATGGTTTACATTTGTATGG - Intergenic
933449319 2:82426766-82426788 ACTTATGATAAACATTGTTTAGG + Intergenic
933548836 2:83748356-83748378 AATAATGATACATATTTTTTTGG - Intergenic
935381478 2:102455291-102455313 AAGGTTTATAAACAATTTTATGG - Intergenic
935589816 2:104835969-104835991 AGTGATGATAAAGAGTTTTCTGG + Intergenic
937284942 2:120744621-120744643 TATGCTGATAGACATTTATATGG + Intronic
937839220 2:126508873-126508895 AATGATGTGAAACACTTTGAGGG - Intergenic
938983427 2:136548542-136548564 AATGATAGTAAACAGTTTAAGGG - Intergenic
939034467 2:137113985-137114007 AATGATGACATTCATTGTTAGGG + Intronic
939728225 2:145750293-145750315 AATGATGATAATAATTTTAAGGG + Intergenic
940103553 2:150070626-150070648 AGTGTTAATAAAGATTTTTAAGG - Intergenic
940330840 2:152472836-152472858 AATGATGATAATCTGTCTTAAGG + Intronic
940483814 2:154272507-154272529 AAAGATTATAAAGACTTTTAAGG - Intronic
940588968 2:155696333-155696355 AAGGTTAGTAAACATTTTTAGGG - Intergenic
940851550 2:158691886-158691908 TTTGATCATAAACTTTTTTAGGG - Intergenic
940859842 2:158760304-158760326 AGTGTTGATAAACATTTATTGGG + Intergenic
940925783 2:159362350-159362372 AGTAATGATAAACATTATCAAGG - Intronic
941038037 2:160589337-160589359 CATGAATAAAAACATTTTTAAGG + Intergenic
941734752 2:168961417-168961439 AATACTGATAGCCATTTTTATGG + Intronic
942699935 2:178695148-178695170 AAAGATGATAAAAATTGTAATGG - Intronic
943177955 2:184502475-184502497 AGTGATGATGAGCATTTTTTTGG + Intergenic
943201269 2:184828083-184828105 AATAATAATAAATAATTTTATGG + Intronic
943375731 2:187074379-187074401 AATTCTGAGAAACATTTTTTAGG + Intergenic
943672963 2:190683613-190683635 AATCATGATTAAGATTTTAATGG - Intronic
943801254 2:192060960-192060982 AATGATTAAATACATTTTAATGG - Intronic
944179375 2:196871392-196871414 AAAGGAGATAAATATTTTTAGGG + Intronic
944215550 2:197251545-197251567 AATAATGAGAAACCATTTTATGG - Intronic
944270528 2:197780444-197780466 AATAAATATAAACATTTGTATGG - Intronic
945238030 2:207650863-207650885 AATGTTCATCAGCATTTTTATGG + Intergenic
945423956 2:209675823-209675845 ATTACTGATAAATATTTTTAGGG - Intronic
945540063 2:211074454-211074476 ACAGAAGATTAACATTTTTAGGG + Intergenic
945748077 2:213743502-213743524 TATGCTGAAAAACATTTTTTAGG - Intronic
946150720 2:217766584-217766606 AATGATGATATGCTTTTCTATGG - Intergenic
946573343 2:221048449-221048471 AATAAAAATAAACATTTTTAAGG - Intergenic
946650137 2:221884308-221884330 AATGATTAAAAATAATTTTAGGG + Intergenic
947784541 2:232804141-232804163 AATTATCCTAAAAATTTTTATGG - Intronic
947842203 2:233215067-233215089 AATGATGAAGAACCTTGTTAAGG + Intronic
947842209 2:233215098-233215120 AATGATGAAGAACCTTGTTAAGG + Intronic
947842216 2:233215130-233215152 AATGATGAAGAACCTTGTTAAGG + Intronic
947842222 2:233215161-233215183 AATGATGAAGAACCTTGTTAAGG + Intronic
947842228 2:233215192-233215214 AATGATGAAGAACCTTGTTAAGG + Intronic
947842234 2:233215223-233215245 AATGATGAAGAACCTTGTTAAGG + Intronic
947842240 2:233215254-233215276 AATGATGAAGAACCTTGTTAAGG + Intronic
947842246 2:233215285-233215307 AATGATGAAGAACCTTGTTAAGG + Intronic
947842252 2:233215316-233215338 AATGATGAAGAACCTTGTTAAGG + Intronic
947842259 2:233215347-233215369 AATGATGAAGAACCTTGTTAGGG + Intronic
948417174 2:237817925-237817947 AATGAAGGTAAAGATTTTTGTGG + Exonic
948443693 2:238015697-238015719 CATGATGATAAATATTTTAGGGG + Intronic
948911253 2:241003883-241003905 AATGATAACCAACATTTTTTTGG - Intronic
1169314170 20:4574351-4574373 AATGCTGAGAATCATTTTAAAGG + Intergenic
1169635312 20:7684380-7684402 AATGAAGATAAAAATATTAATGG + Intergenic
1169640510 20:7745529-7745551 AGTGATGAAATACATTATTAAGG + Intergenic
1170459039 20:16559379-16559401 TATGCTGATAACCATATTTAGGG - Intronic
1170915620 20:20621719-20621741 AATAATGTTAAACAATTTAAAGG + Intronic
1170954727 20:20968748-20968770 TATGATTAGAAATATTTTTAAGG - Intergenic
1171901145 20:30858674-30858696 AAAGATGTAAAAAATTTTTATGG + Intergenic
1172389566 20:34557941-34557963 ACTGAAGATCAACATTTTTTTGG - Intronic
1173383780 20:42569803-42569825 AATGATGATAAACGTCTTCTTGG - Intronic
1177161294 21:17551003-17551025 AATTATGATAAGCCTTTGTAGGG + Intronic
1177399332 21:20582444-20582466 AAAGATGATATACGTTTTCAAGG + Intergenic
1177451423 21:21272634-21272656 AATGAAGAGAGACATATTTAAGG + Intronic
1177455708 21:21334863-21334885 AATAATTATCAATATTTTTAAGG - Intronic
1177659105 21:24059316-24059338 AATAATGTCAAACAGTTTTATGG - Intergenic
1178025503 21:28461661-28461683 AGTGAACACAAACATTTTTAGGG + Intergenic
1178276010 21:31237632-31237654 AATGATGAGAAAACTTTCTATGG + Intronic
1178734083 21:35133170-35133192 AATAATGAGAAAAATTTTGAGGG + Intronic
1178982816 21:37279210-37279232 AAAGAATATAAACATTTTAAAGG - Intergenic
1182643709 22:31790430-31790452 AATGAGAATAAACATTTCCATGG - Intronic
1183144934 22:35981736-35981758 ATTGAATATAACCATTTTTATGG + Intronic
1183168847 22:36169504-36169526 AGTAATAATAATCATTTTTACGG - Intergenic
1184494462 22:44829670-44829692 AATGGCAATAAACATTTTAAAGG + Intronic
949091798 3:37701-37723 AAGTATGATTAACATTTTAAAGG - Intergenic
949172996 3:1025166-1025188 AATAAAGATAACCATATTTAAGG + Intergenic
949179341 3:1109106-1109128 AATGAGGCTAAAAATTTTAAGGG + Intronic
949385619 3:3499027-3499049 CATGGTTATAAACATTTTTCTGG + Intergenic
949512869 3:4782008-4782030 AATGCTCACAAACATTTATAAGG - Intronic
951432304 3:22622335-22622357 AAGGATGCTAAACATCTATAAGG + Intergenic
951487790 3:23233345-23233367 AATGATATTAAACAGTGTTATGG + Intronic
951658536 3:25036387-25036409 AAAAATGCTATACATTTTTACGG - Intergenic
952432309 3:33235414-33235436 AATGAATATAAAAATGTTTAAGG - Intergenic
952503608 3:33987889-33987911 AATGATGAGAAAAAATGTTAAGG - Intergenic
952758882 3:36896463-36896485 AATTTTGAAAAACATATTTATGG - Intronic
952870918 3:37900598-37900620 AATGATGGTTAACAATATTATGG - Intronic
953777670 3:45836322-45836344 GATGATGATATTCATTTTTGTGG - Intronic
953961237 3:47267521-47267543 AATATTCATAAACATTTTTAAGG - Intronic
955263319 3:57416814-57416836 AATGATCATAACTAATTTTAAGG + Intronic
955990127 3:64617741-64617763 AATGCTGATCAACATTTTGAAGG - Intronic
956320220 3:67988287-67988309 GAAGAAGATAAACATTTTTTGGG + Intergenic
956944774 3:74207975-74207997 CATGATGATAATCATATTGATGG + Intergenic
956964677 3:74444832-74444854 AATTAAGATTAATATTTTTATGG - Intronic
957002378 3:74900946-74900968 AATGCTGAAAAATATATTTAAGG + Intergenic
957191875 3:77020414-77020436 AAAGAGCATGAACATTTTTAAGG - Intronic
957381047 3:79430075-79430097 ATTGATGATTATAATTTTTAAGG + Intronic
957507625 3:81144195-81144217 ATAGATGTTAAACATTTTGACGG + Intergenic
957662559 3:83179856-83179878 ATTGATGATAAACACTAATAAGG - Intergenic
957766395 3:84630437-84630459 GATGAGGAATAACATTTTTATGG - Intergenic
959000643 3:100960086-100960108 AACTATGATAAACATGCTTAAGG + Intronic
959135657 3:102416593-102416615 GATCATGATAAACTTTTTTTAGG - Intronic
959177981 3:102941131-102941153 CATGAAGATAAACTATTTTAAGG + Intergenic
959188626 3:103080571-103080593 ATTGATTGTAAACATTTCTATGG - Intergenic
959335637 3:105061322-105061344 AAGGCTGATAAACATTTTTCAGG + Intergenic
959463855 3:106660864-106660886 AATGGGCATTAACATTTTTATGG - Intergenic
959967048 3:112367839-112367861 AATTATAATAAACATATTTCTGG - Intergenic
960547884 3:118937730-118937752 AATGAAGATATATAATTTTATGG - Intronic
960606560 3:119511993-119512015 TATAAGTATAAACATTTTTAAGG - Intronic
960946011 3:122967183-122967205 TATTATAATAAACATTCTTAAGG - Intronic
961203803 3:125065138-125065160 TATGAGGAAAAAAATTTTTAAGG + Intergenic
961964696 3:130890057-130890079 ATTTATGATAAACATTTTTCAGG + Intronic
962068445 3:132008774-132008796 ATTGATAATGAATATTTTTATGG - Intronic
962153848 3:132923040-132923062 AATGATGACTAACACTTTTTGGG + Intergenic
962499731 3:135979041-135979063 AATGATTTTAAAAATTTCTAAGG + Intronic
962634603 3:137318007-137318029 AATGAGGAAAAAAATTTTAAGGG - Intergenic
964534433 3:157703880-157703902 AATGATGATAATGAGTATTATGG - Intergenic
964971816 3:162573071-162573093 ACTGATGACAAAAATTTTGATGG + Intergenic
965157975 3:165088736-165088758 ACTGAATATAAACATTTTAAAGG + Intergenic
965287902 3:166842039-166842061 AAAGATTGTAAACACTTTTATGG + Intergenic
965356356 3:167678673-167678695 AATGAAGTTAAACATCTTCAAGG - Intergenic
965381566 3:167995876-167995898 AATGATAATAAACATTTGCTTGG - Intergenic
965416848 3:168406656-168406678 AAAGATGATAAATGTTCTTAAGG - Intergenic
965476170 3:169158211-169158233 GACAATGATAAACAGTTTTATGG - Intronic
965490644 3:169331431-169331453 GATGATAATTAACACTTTTATGG - Intronic
966252433 3:177881176-177881198 AACTATGATAGACATTTTTGGGG + Intergenic
966458664 3:180148613-180148635 AATAATTATATACAATTTTATGG + Intergenic
966465144 3:180223566-180223588 AAAGATGATAAAGAGTTTAAGGG - Intergenic
966700899 3:182849512-182849534 ATTTATTATAAACATGTTTAAGG + Intronic
967244787 3:187475440-187475462 AAGGATGACAAAAAGTTTTAGGG - Intergenic
967626189 3:191687632-191687654 AAAGAATATAAACATATTTAGGG + Intergenic
968822208 4:2862914-2862936 AAGGATGACAATCATTTTCATGG - Intronic
969141240 4:5075436-5075458 AAGATTGAGAAACATTTTTAAGG - Intronic
970373480 4:15432703-15432725 AATTCTGATAAGGATTTTTACGG + Intronic
970535148 4:17023025-17023047 ACAGATGATAAACATGTTCAGGG + Intergenic
970766885 4:19560311-19560333 ATTGATGATGAACTTTATTATGG + Intergenic
970940515 4:21627408-21627430 AATGAGGATTAACAGTTTTTTGG - Intronic
970957280 4:21828845-21828867 AATAATAACAAATATTTTTAAGG + Intronic
971516142 4:27489185-27489207 TTTGATGTTAAACATTTTTTAGG - Intergenic
971555787 4:28012226-28012248 AATGGTGATAAACATTGTGATGG - Intergenic
971822897 4:31581771-31581793 TCTAATGATAAATATTTTTATGG - Intergenic
971832918 4:31720743-31720765 ATTGATGTTAAATATTTTAAGGG - Intergenic
972010052 4:34167674-34167696 AATCATCAAAAACATTATTAAGG + Intergenic
972066077 4:34945836-34945858 AATGATAATAAAAACTCTTATGG - Intergenic
972107594 4:35509661-35509683 CATGGTGATAAAGATTTGTATGG - Intergenic
972440216 4:39081407-39081429 AATTATGATAACCATTTTAAAGG - Intronic
973289908 4:48460744-48460766 AATGTCCATAAACATTTTAAGGG + Intergenic
973309357 4:48691179-48691201 AAAGATCATAAACATTTTAGAGG - Intronic
973587424 4:52407506-52407528 AATTATTTTAAACATTTTTATGG - Intergenic
974064743 4:57067141-57067163 AATGATGATATATATTTTCAAGG + Intronic
974142193 4:57901202-57901224 AATGATGTTAAACTCTTTTAAGG - Intergenic
974385225 4:61195840-61195862 AATTATAATAAAGAGTTTTAAGG + Intergenic
974413175 4:61568219-61568241 AATATCTATAAACATTTTTAAGG + Intronic
974455609 4:62126000-62126022 TATGATTTTAACCATTTTTATGG + Intergenic
975059691 4:69982262-69982284 AATGATGGTGAAAATTTTTTTGG + Intergenic
975190938 4:71461381-71461403 AATAATTATAAACCTGTTTAGGG - Intronic
975233422 4:71961920-71961942 CATAATGTTAAACATTTATATGG - Intergenic
975343383 4:73266385-73266407 AATCAGGAGAAACATTTTCAAGG + Intergenic
975359160 4:73446592-73446614 AAAGATGATTATCATTCTTACGG + Intronic
975359163 4:73446656-73446678 AAAGATGATTATCATTCTTACGG + Intronic
975391815 4:73827581-73827603 AATGATGTTGAACACCTTTAAGG - Intergenic
975429628 4:74273593-74273615 AATTATAATAGACATTTTCAAGG - Intronic
975893349 4:79055799-79055821 TTTAATGGTAAACATTTTTAAGG + Intergenic
976081787 4:81363246-81363268 AATGATAATACACATAGTTAAGG + Intergenic
976790893 4:88877264-88877286 AAAGGTTATAAACATATTTATGG - Intronic
976926677 4:90506443-90506465 AATGCTGAAAAACATTTATTTGG - Intronic
977073622 4:92424994-92425016 ATTGTTATTAAACATTTTTAAGG + Intronic
977282473 4:95058879-95058901 AATGATTATGCACTTTTTTATGG + Intronic
977298396 4:95237343-95237365 AATGGGAATAAAAATTTTTATGG - Intronic
977407408 4:96617557-96617579 AATGATGGTAAACATTTGAATGG - Intergenic
977871381 4:102094469-102094491 AAAGAAAATAAACATTTATATGG - Intergenic
977886188 4:102254432-102254454 AATTATGATAAACCATTGTAGGG - Intronic
978024680 4:103858447-103858469 AATCATTATAAACTTTTTGAAGG + Intergenic
978089764 4:104700854-104700876 AATGTGGATAAGCATTTTAAAGG - Intergenic
978381010 4:108128891-108128913 ACTTATGATGGACATTTTTATGG - Intronic
978837751 4:113173525-113173547 AACGATGATAAACTTTTGTTGGG - Intronic
979008201 4:115332057-115332079 AATGATGTTGAAACTTTTTATGG - Intergenic
979204072 4:118013682-118013704 AATGAATATAAACTTTTCTATGG + Intergenic
979296818 4:119042305-119042327 AATGAGTATAAATATTTCTAGGG + Intronic
979662092 4:123268714-123268736 CATGAAGATAAACATGTTTTAGG - Intronic
980453656 4:133009977-133009999 AAAGATGAAAAAAAGTTTTAAGG + Intergenic
980500116 4:133639468-133639490 AATAATGAGTAACATTTGTATGG + Intergenic
980514895 4:133842979-133843001 AATGATGATTTACATATTGAAGG + Intergenic
980587106 4:134831366-134831388 AATGAAGATAAAAATGTTAAGGG + Intergenic
981467418 4:145089429-145089451 AATGTTGAAAAACAAATTTAGGG - Intronic
981552952 4:145960214-145960236 AATGAGGTAAAACATTTGTATGG - Intergenic
981570957 4:146149992-146150014 AATTATGATTAACATGTTAAGGG - Intergenic
981633838 4:146852293-146852315 AATGTTATTAAACATTTATATGG + Intronic
982037207 4:151357296-151357318 AATGCTTAAAAACATTTTAAGGG - Intergenic
982471938 4:155803009-155803031 GAAGAAGATAAACATTTATAAGG + Intronic
982918363 4:161243587-161243609 AATGATTATCAACGTTTATATGG - Intergenic
983065700 4:163207757-163207779 AGTGATGATGAGCATTTTGATGG + Intergenic
983141576 4:164155905-164155927 AAAGATGAAAATCATTTTGAGGG - Intronic
983250592 4:165341721-165341743 AAAAATGATAAAGATTATTAAGG - Intronic
983400365 4:167256367-167256389 AATGGTGATTTATATTTTTATGG - Intergenic
983605039 4:169573783-169573805 ATTGATAATAAAAATTTTAATGG + Intronic
983803948 4:171969675-171969697 AATCAGTATTAACATTTTTAAGG - Intronic
984123990 4:175782338-175782360 AAGGATGATTAAGATTTTGAAGG - Intronic
984268191 4:177519411-177519433 GATGATGATAAAGATCCTTATGG - Intergenic
984680556 4:182604123-182604145 AAAGGAAATAAACATTTTTATGG - Intronic
984916469 4:184729709-184729731 AAAGTTCATAAACAGTTTTAAGG + Intronic
985281925 4:188295795-188295817 AATGATGAAATACATGCTTACGG + Intergenic
985312860 4:188620707-188620729 GATACTGAGAAACATTTTTATGG - Intergenic
985480106 5:104646-104668 AATTTTGATAATCATTTTTCTGG + Intergenic
986039326 5:3972754-3972776 AATGTTTCTAAAAATTTTTAGGG + Intergenic
986628380 5:9744778-9744800 AAATATGATAAACATTTTCTAGG - Intergenic
986791715 5:11167650-11167672 CAAGATGATAAACATTTAGATGG + Intronic
988676078 5:33434358-33434380 CATGATGATACACATTCTGAAGG - Intergenic
989273594 5:39560322-39560344 AATGAGTATAAATATTTATATGG - Intergenic
989371314 5:40711284-40711306 AAAGATGCTCAACATTATTAGGG + Intergenic
989382843 5:40826153-40826175 AATAATTTTAATCATTTTTAAGG + Exonic
989623701 5:43409843-43409865 CAGGATGATAGACATGTTTATGG + Intronic
990702338 5:58487660-58487682 TAAAATGATAAACATTATTATGG - Intergenic
990719840 5:58682068-58682090 CATGAGGAGAAACATTTGTATGG + Intronic
990866974 5:60390534-60390556 AGTGCTGATAACCAATTTTATGG - Intronic
991296683 5:65089045-65089067 AATGATGCTAAATATCTTTAGGG - Intergenic
991530543 5:67609162-67609184 AATGAAGAGTAACATTTTTACGG - Intergenic
991701978 5:69324914-69324936 AATGATGGTAAACAAATTAATGG + Intronic
992250283 5:74869371-74869393 GATGATGATAAATCTTTCTAAGG - Intergenic
992272717 5:75082133-75082155 AATGATGAAAAACACTTTTGAGG + Intronic
993069834 5:83146526-83146548 ATTGATGATAAAAATCTTTCTGG + Intronic
993171304 5:84422353-84422375 AATGATTGTAAACATACTTAGGG - Intergenic
993242470 5:85408286-85408308 AATGATCAGAAATATTTTTTAGG + Intergenic
993482519 5:88441751-88441773 AATGTTTAGAAACATTCTTAAGG - Intergenic
993608014 5:90018155-90018177 AATCATGATTACCATTTTGATGG - Intergenic
993790468 5:92202494-92202516 ACTAATGGTAAGCATTTTTAAGG + Intergenic
993807823 5:92435549-92435571 CATAAAGATAAACACTTTTATGG - Intergenic
993932494 5:93956898-93956920 AATGAATATGAACATTATTATGG - Intronic
994471680 5:100215825-100215847 AAAAATGATAAACATTTTATTGG + Intergenic
994548308 5:101199266-101199288 AATGACCTTAAACATTTTTTAGG + Intergenic
994879783 5:105475304-105475326 AATGATGTTAGACATTTTCAAGG + Intergenic
995546412 5:113236613-113236635 AGTGAAGATAAACATTATAATGG - Intronic
995546494 5:113237443-113237465 AATGTTCAAAAATATTTTTATGG + Intronic
995893348 5:116982332-116982354 AATGATAATAAATATTTTACTGG + Intergenic
996961691 5:129257332-129257354 AATGGTGTTAAACTTTTATATGG - Intergenic
997059270 5:130480968-130480990 AATGTTCATAAACATTTAAATGG + Intergenic
997124301 5:131210488-131210510 GGTGAAGATAAATATTTTTAGGG - Intergenic
997164783 5:131648397-131648419 ATTGATGCTAAACATGTTTGAGG + Intronic
998747867 5:145282174-145282196 AATAATAATACTCATTTTTATGG + Intergenic
998912655 5:146977136-146977158 AAAAATGATGACCATTTTTAAGG - Intronic
999641488 5:153677572-153677594 AGTACTGAGAAACATTTTTAGGG - Intronic
1000738270 5:164932856-164932878 AATGATGAAAAAAATGTTAAGGG - Intergenic
1000870702 5:166573718-166573740 AGTGATGATAAATATGTTAAAGG + Intergenic
1000908282 5:166989696-166989718 AATAATGGTAAATATTTTTGCGG - Intergenic
1001139023 5:169127886-169127908 AAATGTTATAAACATTTTTAAGG - Intronic
1003306803 6:4936201-4936223 AAAGATGATAAATATTCTGAAGG - Intronic
1003349691 6:5304477-5304499 AAAGAGTATGAACATTTTTATGG + Intronic
1003659794 6:8049506-8049528 AATTATGTAAAACATTTATATGG + Intronic
1004537038 6:16513174-16513196 AATGAAGATAAACATGTTGCTGG - Intronic
1005019027 6:21400148-21400170 AATAATCATAAAAATTTTTTAGG + Intergenic
1005286128 6:24328749-24328771 AATGTTGATAAGCATTTCAAGGG - Intronic
1005369235 6:25113264-25113286 AATGATGATAAATTGTTTAATGG - Intergenic
1005880077 6:30050392-30050414 AAAGATGATCGACATTATTAGGG + Intergenic
1007036284 6:38677431-38677453 AAGAAAGAAAAACATTTTTATGG - Intronic
1007870340 6:45028837-45028859 AAGGCAAATAAACATTTTTATGG - Intronic
1007902897 6:45427761-45427783 AAAGATGAGAAACTGTTTTAAGG + Intronic
1008176863 6:48278798-48278820 AATGATGATAAAGACTATTTTGG - Intergenic
1008232841 6:49005748-49005770 AATGCAGATAAAAATTTCTAAGG + Intergenic
1008318647 6:50079327-50079349 AATGATCATAAAAATTCTCAAGG + Intergenic
1008426239 6:51360529-51360551 AATGATAATTGACATTGTTATGG - Intergenic
1008498733 6:52158637-52158659 AATGATCATAAAAATTTCCAAGG + Intergenic
1008707704 6:54182697-54182719 AAAAATGATAAACATTTAGAAGG - Intronic
1008788026 6:55194014-55194036 AATGAAACAAAACATTTTTAGGG - Intronic
1008790827 6:55230617-55230639 AATACTGATAAACAGATTTATGG + Intronic
1008819281 6:55610752-55610774 AATGAAGGAAAACATTTTAAGGG + Intergenic
1009518211 6:64646931-64646953 AGTTATGACAAACATTTGTAAGG + Intronic
1009748008 6:67845358-67845380 GATGATCATTAACATTTTTTGGG - Intergenic
1009848068 6:69159229-69159251 AATAATGAAAGACATTTTTTAGG - Intronic
1009974861 6:70661756-70661778 AAAGATGAGAAACAGGTTTAGGG - Intergenic
1010342539 6:74771873-74771895 AATGATGGTAAACAGTATGAAGG - Intergenic
1010683083 6:78819233-78819255 AATGAAGAAAAAAATTTTAAGGG + Intergenic
1011303188 6:85897721-85897743 ATGGATGATAAAAAGTTTTAGGG - Intergenic
1011506783 6:88053669-88053691 ACTGATGAAAAACATTTTTAAGG + Intronic
1011693297 6:89888864-89888886 AAAGAGAATAAACATTTTTAGGG - Intergenic
1011827652 6:91329360-91329382 TGTGATGATAAACATTTATCAGG + Intergenic
1012007213 6:93728168-93728190 AAGCATGATAAATACTTTTATGG - Intergenic
1012340304 6:98113302-98113324 AATGATGAAAAACAAATCTATGG - Intergenic
1012422715 6:99081975-99081997 AATATTGATACACATTTTTAAGG + Intergenic
1012654499 6:101798145-101798167 AATAAACATAAATATTTTTAAGG + Intronic
1012718419 6:102707118-102707140 CATGATGATAAAAGTTTTTCAGG - Intergenic
1013270882 6:108544610-108544632 CATAATGATAAATATTTATAAGG + Intergenic
1013633662 6:112008893-112008915 ATTGGTTATAAACATTTTTCTGG + Intergenic
1013637293 6:112041263-112041285 AATTGTAATAAACATTTTTGGGG + Intergenic
1013962459 6:115916732-115916754 AACTATGAGAAACATATTTAAGG - Intergenic
1013969945 6:116004870-116004892 AATGATGATGACCATTTTTATGG - Intronic
1013986752 6:116203051-116203073 TATGATATTAAACATTTTTATGG + Intronic
1014076240 6:117238329-117238351 AATCAGGTTAAACATCTTTATGG - Intergenic
1014178524 6:118356628-118356650 TATAATGTTAACCATTTTTAAGG - Intergenic
1014477724 6:121895318-121895340 AAGTATGTAAAACATTTTTAAGG + Intergenic
1014520022 6:122430933-122430955 AATAGTGATAAAGAGTTTTAAGG + Intronic
1014584334 6:123180466-123180488 AATTATGAATAACATTTTCATGG + Intergenic
1014829487 6:126085254-126085276 AAAAAAGATGAACATTTTTAGGG - Intergenic
1014903598 6:126999870-126999892 AATGATTATTAACATTTATTGGG - Intergenic
1014969747 6:127800020-127800042 AATAATGAACAACATTTTAAGGG - Intronic
1015474339 6:133643108-133643130 AGTGATAATAAACATTTTGATGG + Intergenic
1015482250 6:133725350-133725372 AATGTTGATAAACAATTGTAGGG + Intergenic
1015498438 6:133905461-133905483 AATAATCATAATGATTTTTATGG - Intergenic
1015627672 6:135197646-135197668 AATGATGTTAACAATTTTAAAGG - Intronic
1016045489 6:139476595-139476617 TATGATTATCAATATTTTTATGG - Intergenic
1016111170 6:140226101-140226123 AATGATGGTAATAATTTTTCTGG - Intergenic
1016708554 6:147142637-147142659 AAGGAGGATAAATATTTTTGTGG + Intergenic
1017230836 6:152071895-152071917 AAAGGGTATAAACATTTTTAAGG + Intronic
1018076348 6:160217591-160217613 AATGATTATAAACTTTGTTCAGG + Intronic
1018150992 6:160939601-160939623 ATTGAGAATAACCATTTTTAAGG - Intergenic
1018352784 6:162978860-162978882 ATTGATTTTTAACATTTTTAAGG + Intronic
1018413282 6:163578024-163578046 AATTTTAATAAACATTTTTTGGG - Exonic
1019075229 6:169381617-169381639 AATGATGATGAATAGTTATATGG + Intergenic
1019125403 6:169837329-169837351 AATGAGGACAAACATTTCTTAGG - Intergenic
1020504083 7:8961166-8961188 AATAATGACAAACATTTTTCGGG + Intergenic
1020508629 7:9023875-9023897 AATGATGAAATTCATTTTTCTGG - Intergenic
1021074255 7:16281111-16281133 AATGATGGTAAAAATTTATGTGG - Intronic
1021106906 7:16647453-16647475 AATAATGATAAACATATTCCAGG - Intronic
1021384267 7:20008651-20008673 ATTGATGTTAAGCATCTTTAGGG - Intergenic
1021819460 7:24481683-24481705 AATCATGATAATCACTTTAAGGG + Intergenic
1021869924 7:24995183-24995205 AATAAAGTTAAACAATTTTAAGG - Intergenic
1022188501 7:27993921-27993943 AATGATTATAAAAATGTTTATGG - Intronic
1022752571 7:33245807-33245829 AAAGAAAATAAACATCTTTAAGG + Intronic
1022984027 7:35632648-35632670 AATTATGGTAAACAGTTTTATGG - Exonic
1023252474 7:38280264-38280286 AATGGTAATAACCATTTATAGGG - Intergenic
1023471010 7:40519657-40519679 AAGTATAATAAACATTTTAATGG + Intronic
1024182134 7:46907300-46907322 AATAATGAGTAACTTTTTTATGG + Intergenic
1026159317 7:67854664-67854686 AATGATGAAACAAATTTTAAAGG - Intergenic
1027496754 7:78897146-78897168 AAATATGATAAATATGTTTAAGG - Intronic
1027535724 7:79398552-79398574 ACTGATGAAAAACAGTATTACGG - Intronic
1027962352 7:84962461-84962483 AATGAAGAGAAACATATTTTAGG - Intergenic
1028307719 7:89287018-89287040 AATGAGGATGAAGATTTTTATGG + Intronic
1028413503 7:90556413-90556435 AATAATGATAATCCTTTTTAAGG + Intronic
1028448215 7:90949695-90949717 AATGAATCTAAACATTTTTAAGG + Intronic
1028960279 7:96740868-96740890 AATCATAATAAAAATTTTCAAGG + Intergenic
1029242652 7:99175151-99175173 AATGGTGATAAGCATTTTCCAGG - Intronic
1030164238 7:106537148-106537170 AAAGGTGTTTAACATTTTTAAGG + Intergenic
1030449101 7:109686636-109686658 AATGATTATAAGCTTTTTGAGGG + Intergenic
1030542888 7:110855012-110855034 AGTTATAATACACATTTTTAAGG + Intronic
1030578326 7:111318475-111318497 AATGATGATGATGATTTCTATGG - Intronic
1030709557 7:112734058-112734080 AATGATGAAAAAGATATTTTAGG - Intergenic
1031637722 7:124121240-124121262 AATGATAATAAACTATGTTATGG + Intergenic
1031855157 7:126913607-126913629 AATGATGCTAAGGATATTTAGGG - Intronic
1031898209 7:127378863-127378885 AAAGATTATAAAGCTTTTTAAGG - Intronic
1031938691 7:127764141-127764163 AATAATGATACAATTTTTTATGG + Intronic
1031963323 7:128009026-128009048 AGTAATAATAAGCATTTTTATGG + Intronic
1032759147 7:134922287-134922309 AAAAATAATAGACATTTTTATGG - Intronic
1032867177 7:135937811-135937833 AATGAGGATAAAGGTCTTTATGG + Intronic
1033247156 7:139727242-139727264 AATGATGATAAACACAATTAAGG + Intronic
1034054607 7:148021499-148021521 AAAGATGAGAAGCATTTCTAGGG + Intronic
1034779502 7:153865178-153865200 AATAAAGAAAAACATTTTTTGGG + Intergenic
1035420066 7:158720205-158720227 AATGAAGACAAACATTTTTACGG - Intergenic
1037100840 8:15043770-15043792 AATGATTCTAAATATTTTTTTGG - Intronic
1038436163 8:27538192-27538214 CATGATGATAAAGATGTTAAAGG - Intronic
1039002951 8:33001979-33002001 AATGATGATCAGCATTTTTCTGG + Intergenic
1039093748 8:33860243-33860265 AATGATATTAAACATGATTAAGG - Intergenic
1039980065 8:42401846-42401868 AATGTTGATATAGATTTTTCTGG + Exonic
1040577862 8:48670138-48670160 AATGATGATGAAGTTATTTAGGG + Intergenic
1040654768 8:49494096-49494118 AATGATTTTAAAAATTTTGATGG + Intergenic
1040674607 8:49733700-49733722 CATGGTGATAAACAATTATAAGG + Intergenic
1040703452 8:50095998-50096020 ATGAATGACAAACATTTTTAAGG + Intronic
1041474715 8:58250436-58250458 AATGATGAAAAAAATGTTAAGGG + Intergenic
1042208890 8:66357742-66357764 AATGCTGACAAGGATTTTTAGGG - Intergenic
1042256962 8:66815105-66815127 AATGATGATTACCATTTATATGG + Intronic
1042708166 8:71684368-71684390 AAAGATAATAAACATTTCAAAGG - Intergenic
1042853034 8:73235602-73235624 AGTGATGATGAGCATTTTTTCGG + Intergenic
1043417807 8:80069482-80069504 AATTTTAATAAAAATTTTTAGGG + Intronic
1043500888 8:80854145-80854167 AATGATGGTAAACAGCGTTAAGG + Intronic
1043589858 8:81817443-81817465 ATAGATCATAAAGATTTTTAGGG - Intronic
1044075405 8:87815759-87815781 AATGCAGATAAACCTATTTATGG - Intergenic
1045104113 8:98874612-98874634 AAAAATTATAAACATTTTGATGG - Intronic
1045191766 8:99890734-99890756 TATTATCAAAAACATTTTTACGG + Intronic
1046301089 8:112291442-112291464 AAAGATGATAAACATTCCTATGG + Intronic
1046348140 8:112964380-112964402 TATGAAGGTAAACATATTTAGGG - Intronic
1046914915 8:119669827-119669849 AATGATGATTAACTTTGATAGGG - Intronic
1046987534 8:120405165-120405187 ATTAATGATACACATTTTTCAGG + Intronic
1047065075 8:121272868-121272890 AATGATGAGAACCATTCCTAGGG + Intergenic
1047264490 8:123293388-123293410 AATGATTTTATACATATTTATGG - Intergenic
1047352821 8:124092223-124092245 AGTGATGATATGCCTTTTTACGG + Intronic
1047584613 8:126257476-126257498 AAGGATGCAAAACATCTTTAAGG - Intergenic
1047723793 8:127667197-127667219 CATGGAGATAACCATTTTTAAGG - Intergenic
1047880949 8:129192836-129192858 AATGATGATAAATAGGTTTCAGG + Intergenic
1047913680 8:129558807-129558829 ATTGAAATTAAACATTTTTATGG - Intergenic
1049926479 9:413641-413663 AATGATGCTGAACATCTTCATGG - Intronic
1050035279 9:1429082-1429104 AATGATGAATTTCATTTTTAAGG - Intergenic
1050126786 9:2364900-2364922 AATGATAAATGACATTTTTAAGG - Intergenic
1050225545 9:3450799-3450821 AATGATCCTAAGGATTTTTAAGG - Intronic
1050515521 9:6440073-6440095 AGTTAAGATTAACATTTTTAAGG + Intronic
1050779023 9:9306641-9306663 AATGAAGGCACACATTTTTAGGG + Intronic
1050926223 9:11266945-11266967 AATAATGGTAAATATTTATAAGG + Intergenic
1051300578 9:15645964-15645986 AATGAAGATAAAAATGTTAAGGG + Intronic
1051546893 9:18286373-18286395 GATGATGATAAACTTTTTGTTGG + Intergenic
1051967712 9:22848695-22848717 AATAATGAAAAACAGTTTAATGG - Intergenic
1052597689 9:30581314-30581336 AATAATGATCAAAATTTTAAAGG + Intergenic
1052771169 9:32691245-32691267 AAAAATGATAAACATTTTTGTGG + Intergenic
1053513454 9:38709072-38709094 AGTGATGCTGAACATGTTTAAGG + Intergenic
1053553927 9:39114482-39114504 AAAGATGAAAAGCATTGTTAGGG - Intronic
1053620677 9:39811241-39811263 AAGGATGACAGAGATTTTTAAGG - Intergenic
1053626033 9:39872694-39872716 AAGGATGACAGAGATTTTTAAGG + Intergenic
1053818038 9:41934618-41934640 AAAGATGAAAAGCATTGTTAGGG - Intronic
1053878843 9:42570525-42570547 AAGGATGACAGATATTTTTAAGG - Intergenic
1053893824 9:42723840-42723862 AAGGATGACAGATATTTTTAAGG + Intergenic
1054108292 9:61078266-61078288 AAAGATGAAAAGCATTGTTAGGG - Intergenic
1054217855 9:62378007-62378029 AAGGATGACAGAGATTTTTAAGG - Intergenic
1054232846 9:62531170-62531192 AAGGATGACAGATATTTTTAAGG + Intergenic
1054263487 9:62896203-62896225 AAGGATGACAGAGATTTTTAAGG + Intergenic
1054612565 9:67252859-67252881 AAAGATGAAAAGCATTGTTAGGG + Intergenic
1055053895 9:72006056-72006078 TATGATAAGAAACATTTATAAGG + Intergenic
1055111890 9:72567888-72567910 GAAGATGATAAACAATTTTTAGG - Intronic
1055170292 9:73249210-73249232 CATGATAATAAATATTTTTAGGG + Intergenic
1055634302 9:78260202-78260224 AAAGCAAATAAACATTTTTAAGG - Intronic
1055743661 9:79418052-79418074 AAATGTGATAAATATTTTTACGG + Intergenic
1056142749 9:83699223-83699245 TATCATGTTAACCATTTTTAAGG - Intronic
1056258657 9:84825645-84825667 AATCATGATAATCATTGTTATGG - Intronic
1056339051 9:85605672-85605694 AATAATGATAAAACTTTTCAAGG + Intronic
1056679868 9:88707541-88707563 AAAGAATATAAACATATTTAAGG - Intergenic
1058020349 9:100079585-100079607 AATTATAATATATATTTTTATGG - Intronic
1058361543 9:104152762-104152784 AGTGAATATAAACATGTTTAAGG - Intergenic
1058474255 9:105315087-105315109 AAAGATGAAAGAAATTTTTAGGG + Intronic
1058752096 9:108049579-108049601 AATGTTTGCAAACATTTTTAAGG - Intergenic
1058809766 9:108628085-108628107 AATGATGAAAAAGAATTGTAGGG - Intergenic
1059899252 9:118904556-118904578 AATACTGGTAAAAATTTTTAAGG - Intergenic
1060088096 9:120719716-120719738 AAAGAGTATAAACACTTTTAAGG - Intergenic
1060317839 9:122529626-122529648 AAGGATGAGAAACCCTTTTAGGG - Intergenic
1060320801 9:122558931-122558953 AATGATTATACATATTTATAAGG + Intergenic
1061525199 9:131155242-131155264 AGTGATGTTAAGCATTTTTTTGG + Intronic
1186073521 X:5850282-5850304 ACTAATGATACACATTTTCAAGG + Intronic
1186265906 X:7833591-7833613 CATGACTATAAACATTTTTTGGG + Intergenic
1186710988 X:12196207-12196229 AATGATCATAAACATCTCCAAGG + Intronic
1187631720 X:21180479-21180501 AAGGCTGAGAAACACTTTTAAGG - Intergenic
1187842991 X:23508221-23508243 AATTCTGATCAACATTTTCAAGG + Intergenic
1188208432 X:27388849-27388871 AATAAAGAGAAACCTTTTTATGG + Intergenic
1188327160 X:28819621-28819643 AATGCTTATAAACATTTTGCAGG + Intronic
1188383227 X:29523586-29523608 ACTGATTATATACACTTTTAAGG + Intronic
1188515861 X:30985202-30985224 AATGATGAAAAACATAATTGAGG + Intergenic
1188690384 X:33121699-33121721 AATGACTAGAAATATTTTTAGGG + Intronic
1190371867 X:49750360-49750382 AACCATGAAAAACATTTTTTGGG + Intergenic
1191661038 X:63650757-63650779 AATCATTATACATATTTTTAAGG - Intronic
1191768666 X:64731730-64731752 AATGAAGAAAGACATTGTTAAGG - Intergenic
1191836024 X:65462934-65462956 AATGATTTTATTCATTTTTACGG - Intronic
1192019408 X:67369390-67369412 TATGATCTTATACATTTTTATGG - Intergenic
1192976724 X:76294053-76294075 AGTGATGATGAGCATTTTTCAGG + Intergenic
1193194486 X:78614739-78614761 AAAGAATATATACATTTTTATGG - Intergenic
1194138308 X:90175862-90175884 AATGATGTTTAACGTTTTTCGGG - Intergenic
1194321537 X:92453238-92453260 CACTATGATAAACATTTTTTTGG + Intronic
1194930578 X:99882235-99882257 AATGAAGAAAAACATGTTAAGGG + Intergenic
1195124367 X:101791083-101791105 AATGATTATATACATTTATGGGG + Intergenic
1195465531 X:105174624-105174646 AATGATTAAAAAAATTTTTGAGG + Intronic
1195985756 X:110628035-110628057 AATGAAGAAAAACATGTTAAGGG + Intergenic
1196211977 X:113006351-113006373 AATTATGATTAACTGTTTTATGG - Intergenic
1196260869 X:113579647-113579669 AATTATGATAAATATGTTAAGGG + Intergenic
1196391879 X:115215940-115215962 AATTATTATGAACAGTTTTAAGG - Intronic
1196906934 X:120446659-120446681 AATGAAAACACACATTTTTATGG + Intronic
1197359881 X:125487872-125487894 GCTGATTCTAAACATTTTTATGG - Intergenic
1197636947 X:128925958-128925980 AATAAAAATAAAGATTTTTATGG - Intergenic
1198412329 X:136383375-136383397 AATAATGATAAATATGTTTAGGG - Intronic
1198732649 X:139749298-139749320 AATGAAGATACACAAATTTAAGG - Intronic
1200306965 X:155036261-155036283 AATGATGTTGAGCATTTTCACGG + Intronic
1200309006 X:155057919-155057941 AATGAGGATACACATTCTTGGGG - Exonic
1200312523 X:155093025-155093047 ACTGATGATAAGCCTTTGTAGGG + Intronic
1200484107 Y:3746101-3746123 AATGATGTTTAACGTTTTTCGGG - Intergenic
1200629710 Y:5566714-5566736 CACTATGATAAACATTTTTTTGG + Intronic
1201252956 Y:12079109-12079131 AATGAAGAAAATCATTTTTTTGG - Intergenic
1201450947 Y:14114623-14114645 AAAGATATTAAACAATTTTAAGG + Intergenic
1201543349 Y:15133212-15133234 AATGAAGAAAAAAATTTTAAGGG + Intergenic
1201651803 Y:16296598-16296620 AGTGATGATGAGCATTTTTAAGG - Intergenic