ID: 925080619

View in Genome Browser
Species Human (GRCh38)
Location 2:1061290-1061312
Sequence TTTAAGGCAATTAACAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 558}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925080612_925080619 28 Left 925080612 2:1061239-1061261 CCGTGTGATCCTGGGTTGGACGC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 925080619 2:1061290-1061312 TTTAAGGCAATTAACAAAAATGG 0: 1
1: 0
2: 2
3: 51
4: 558
925080617_925080619 19 Left 925080617 2:1061248-1061270 CCTGGGTTGGACGCTGGGGTGGA 0: 1
1: 1
2: 0
3: 10
4: 188
Right 925080619 2:1061290-1061312 TTTAAGGCAATTAACAAAAATGG 0: 1
1: 0
2: 2
3: 51
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925080619 Original CRISPR TTTAAGGCAATTAACAAAAA TGG Intronic
901378074 1:8854069-8854091 TTTACAACAATTAAGAAAAAAGG + Intergenic
902123772 1:14191116-14191138 TTTAATGCATTTAAGCAAAAGGG + Intergenic
902319958 1:15655039-15655061 AATAAGGTAATTACCAAAAAAGG - Intronic
904451625 1:30616553-30616575 GTTAAGACAATTAACAAAACTGG - Intergenic
905436727 1:37961268-37961290 TTTAAAGCAATTAGCAAAGAAGG - Intronic
905999019 1:42407883-42407905 TTTAAGGCAAGAAGGAAAAAAGG - Intronic
906005993 1:42470968-42470990 TTTACAACAATTAAGAAAAAGGG + Intronic
906533392 1:46537015-46537037 TTCAAGAAAATTAACAACAAGGG - Intergenic
907774939 1:57504926-57504948 GTTAAGGCCATTAAAAACAAGGG + Intronic
908092292 1:60698909-60698931 TCTAAGGAAATTAAAAGAAAGGG + Intergenic
908147385 1:61261101-61261123 TTTAAGGCCACTAAATAAAATGG - Intronic
909115600 1:71531340-71531362 ATTAGGGCAATGACCAAAAAAGG + Intronic
909257086 1:73437932-73437954 TTTTAGACAAAAAACAAAAATGG + Intergenic
909448900 1:75777004-75777026 TTGTAGGGAATTAAAAAAAAGGG - Intronic
909961743 1:81854643-81854665 TTAAAGGAACTTAACAATAATGG + Intronic
910842893 1:91577950-91577972 TTTAAGACACTTAAGTAAAAAGG - Intergenic
911606916 1:99917054-99917076 TTTAAATCAATTAACTCAAAAGG - Intronic
911827192 1:102501671-102501693 TGACAGACAATTAACAAAAAAGG + Intergenic
912229730 1:107778006-107778028 TTTAAGGCAGTTATGAAAAAAGG - Intronic
912637981 1:111316556-111316578 TTTAATGCTATTAACTAAGATGG + Intronic
912986541 1:114438330-114438352 TTTAATGTAATTTAAAAAAATGG - Intronic
913349176 1:117839101-117839123 TTTAAGGAATTCAATAAAAAGGG + Intergenic
913848941 1:123566124-123566146 TTTAAGGTCAATAACAGAAAAGG + Intergenic
914691108 1:150028406-150028428 TTTACCACAATTAAAAAAAATGG - Intergenic
915779272 1:158528274-158528296 TTAAAGGCAATTAAAGAAGATGG + Intergenic
916350215 1:163840996-163841018 ATTAGAGCAATTAACCAAAAAGG + Intergenic
916424409 1:164667074-164667096 TTCAAAGCAATTAACTAGAATGG - Intronic
916520626 1:165560708-165560730 TATGAGGCATTTGACAAAAAAGG + Intronic
917435435 1:175016392-175016414 TTTAAGGCAGTTTACAAATGAGG + Intronic
917902643 1:179558050-179558072 TTTAACACAATAAACAAAATTGG - Intronic
918479523 1:184963265-184963287 TTTAAGCAACTTAACGAAAAGGG + Intronic
918648835 1:186934621-186934643 TTTAAGGAAATGAAATAAAAAGG - Intronic
918747931 1:188230001-188230023 CTTAAGGATATTAACAAAGATGG - Intergenic
919261656 1:195203073-195203095 ATTAATTCAACTAACAAAAAAGG - Intergenic
919343519 1:196345112-196345134 GTTATGGCAGTTAACAAAAAAGG + Intronic
920780629 1:208987639-208987661 ATAAAGGCAAATACCAAAAAAGG - Intergenic
921240983 1:213182033-213182055 TTTAAGGCAATTATAAATGAGGG + Intronic
923732374 1:236564879-236564901 TTTAAGACAAAAAACAAAACAGG + Intronic
923759237 1:236825296-236825318 TTTAAGGCAATTTGCAATAATGG + Intronic
1064264630 10:13815563-13815585 TTTGACACAATTAAAAAAAAAGG + Intronic
1064737444 10:18397161-18397183 TTTAAAGCATTAAAGAAAAAGGG + Intronic
1064761588 10:18626919-18626941 TTTAAGACTTTTATCAAAAAGGG + Intronic
1064844662 10:19638256-19638278 TTCATGGAAAATAACAAAAAGGG - Intronic
1064997677 10:21310884-21310906 ACTAAGGTAATTAAAAAAAATGG - Intergenic
1065228065 10:23567478-23567500 TTTAAAACAAACAACAAAAAAGG + Intergenic
1065415028 10:25475259-25475281 TGTAAGGAAAAAAACAAAAACGG + Intronic
1065989757 10:30996897-30996919 TTTTAGGAAATTCACAAAGATGG + Intronic
1066217657 10:33303284-33303306 TGTCAGGTAATTAACAAAGAAGG - Intronic
1066220005 10:33327534-33327556 TATCAGGCTATTTACAAAAATGG - Intronic
1068501452 10:57843701-57843723 TATAAGTCAATTAGCACAAAAGG - Intergenic
1068553015 10:58426885-58426907 TTAAAGGCATTCAGCAAAAAAGG - Intergenic
1068898697 10:62239110-62239132 TTCAAAGCAATAAAAAAAAATGG - Intronic
1069013076 10:63396424-63396446 TTTAAAGCAAAAAATAAAAAAGG - Intronic
1069581758 10:69571493-69571515 TTTAAGCCAATAAAAAAAAATGG - Intergenic
1069752027 10:70751115-70751137 TAGAAGGCAGTTAACAAGAATGG - Intronic
1069758577 10:70791311-70791333 TTTAAAACAATTATCAACAAAGG - Intergenic
1071046368 10:81384372-81384394 TTTAAGACAAATGACAAAAAGGG + Intergenic
1071377791 10:85027734-85027756 CTTAAGCCAGTTACCAAAAAAGG - Intergenic
1071515458 10:86293977-86293999 TTTAAGTCAATTCAAAAATATGG + Intronic
1071619533 10:87106402-87106424 TTTAACGCAATTTACAAAAGGGG + Intronic
1071816395 10:89236122-89236144 TTTATGGTAATAAATAAAAAAGG - Intronic
1072267884 10:93747925-93747947 TGTTAGGGAATTAAAAAAAAAGG - Intergenic
1072448608 10:95520723-95520745 TTTAAGGTATTTAAAAATAAAGG + Intronic
1073308498 10:102522561-102522583 TTTCAGGCAATTACCTGAAAAGG - Intronic
1074957549 10:118407177-118407199 TTTATGTCAATTAACAAATGAGG + Intergenic
1075120947 10:119664346-119664368 TTTAATGCAATGCACAAACAAGG + Intronic
1075500861 10:122972780-122972802 TTTAAAACAAATTACAAAAATGG - Intronic
1075621496 10:123931182-123931204 TGTCTGGCAATTAACAAAAGAGG + Intronic
1075898344 10:126017896-126017918 TTGAGGGCATTTAAGAAAAAGGG + Intronic
1076513848 10:131032130-131032152 TTTAACTCATTTAACAGAAATGG + Intergenic
1077320806 11:1940729-1940751 TATAAGGCAAATGACAAAACTGG + Intergenic
1077814958 11:5677787-5677809 TTTCAGAAAATTAAAAAAAAAGG + Intronic
1079047936 11:17125176-17125198 TTTAAAACAAAAAACAAAAAAGG + Intronic
1079513874 11:21243831-21243853 TTTAAATTAATTAAAAAAAAAGG + Intronic
1079851901 11:25545387-25545409 TTTGAGAAAATTAAAAAAAAAGG + Intergenic
1080081529 11:28224287-28224309 TTTAATACAATTAACCAAAATGG - Intronic
1080619065 11:33971443-33971465 TTTAAAGAAATTATGAAAAATGG - Intergenic
1080985869 11:37464674-37464696 TCTAAGGAAATCAACCAAAATGG - Intergenic
1082018047 11:47507035-47507057 TTTAAGGCATTGAGTAAAAAGGG - Intronic
1082195707 11:49302307-49302329 TTTAAAGCAAAAAACAAGAAGGG - Intergenic
1082212780 11:49525787-49525809 TATGAGGTAATTAACACAAATGG - Intergenic
1082698278 11:56397726-56397748 ATTGAGGAAATGAACAAAAAGGG - Intergenic
1082712646 11:56572055-56572077 TATAAAGCAATTAAAAAATAAGG - Intergenic
1083672692 11:64307848-64307870 TTTGGGAAAATTAACAAAAAGGG - Intronic
1083965090 11:66038764-66038786 TTTGAGGCAAAAAAAAAAAAAGG - Intergenic
1084077612 11:66793392-66793414 TTTGAAAAAATTAACAAAAATGG - Intronic
1084987119 11:72885081-72885103 TTCAAAGGAATTAACAATAATGG - Intronic
1085112441 11:73899819-73899841 CTGAAGGCAATTAAAAAACAAGG - Intronic
1085177160 11:74499570-74499592 TCTAAGGCAAAAAAAAAAAAGGG - Intronic
1085879242 11:80445973-80445995 TTTAAGGCTATTTACAATGAAGG - Intergenic
1085976120 11:81657925-81657947 TTAAAGGCAGTTAGAAAAAAGGG - Intergenic
1086353628 11:85969499-85969521 TTTAATCCAATTGAAAAAAAGGG + Intronic
1086636816 11:89098723-89098745 TATGAGGTAATTAACACAAATGG + Intergenic
1086660229 11:89407268-89407290 TTTAAAGCAAAAAACAAGAAGGG + Intronic
1086764153 11:90674352-90674374 TTAAATGCCATTACCAAAAAAGG + Intergenic
1086822478 11:91451202-91451224 TTAGAGGCAATTGACAAATATGG - Intergenic
1086952741 11:92907790-92907812 TACAAGGCAATTATCCAAAATGG - Intergenic
1086956742 11:92941561-92941583 TTTCAGGCAATGAACAAAAAAGG - Intergenic
1087345240 11:96963831-96963853 TATAGGGCACTTAACATAAATGG + Intergenic
1087685926 11:101265097-101265119 TTTTAGCCACTTAATAAAAATGG - Intergenic
1087841276 11:102923370-102923392 TTTAAGGCCAAAAAAAAAAAAGG + Intergenic
1087851179 11:103031734-103031756 TTTAAGGCAATTGAAAAATTAGG - Intergenic
1087913470 11:103780376-103780398 TTTGTAGCAATTAATAAAAAAGG + Intergenic
1087976065 11:104548429-104548451 TTTAGGGCAATTACCATGAATGG + Intergenic
1088324610 11:108588925-108588947 TTTAAAGGAATTAACTAAATTGG + Intronic
1088567971 11:111193301-111193323 TTTGAGGAAATTAAGAAGAAAGG + Intergenic
1091148936 11:133307943-133307965 TTTAAGTCAATGAACATATATGG + Intronic
1091184474 11:133635536-133635558 TCTCTGGCAATTAACAAACATGG + Intergenic
1091191865 11:133702273-133702295 TTTACTACAATTAAAAAAAATGG - Intergenic
1091258554 11:134214159-134214181 TCTAAGTCCATTAAAAAAAAAGG + Intronic
1092872301 12:12816469-12816491 TTTTTGTCAATTAACAAAACTGG + Intronic
1093018704 12:14182596-14182618 TTAAAGGCCCTTAAAAAAAAAGG + Intergenic
1093100956 12:15028728-15028750 TTAAAGGCAGCTAACAAGAAGGG - Intergenic
1093114921 12:15197657-15197679 ATAAAGGCAAATAATAAAAATGG - Intronic
1093465980 12:19449799-19449821 TTTAAGGCAAGTAAAATATATGG - Intronic
1093885703 12:24457679-24457701 TTTAAATAAATAAACAAAAATGG + Intergenic
1094866710 12:34541825-34541847 TTTCAGGCCATTGGCAAAAAAGG - Intergenic
1096725429 12:53557503-53557525 TTTAAGGGTATTAACAAACGAGG - Intronic
1098031018 12:66254044-66254066 GATAAAGCAATTGACAAAAATGG + Exonic
1098105267 12:67063048-67063070 TTAAATGAAATTAACAAATATGG - Intergenic
1098262929 12:68689635-68689657 TTTAAAGCATTTAATAATAACGG + Intronic
1098785312 12:74746010-74746032 TTGAAGGCAATTAAGAAAGAAGG + Intergenic
1099043780 12:77689759-77689781 TTTAAGGCAATAATTAAAATGGG + Intergenic
1100245765 12:92755218-92755240 TTTAAGGTAATAGACATAAAGGG - Intronic
1102758241 12:115362301-115362323 TTCTAGGCATTTAATAAAAATGG - Intergenic
1105866353 13:24463482-24463504 TTTAAAGCAATTAAAAATAAGGG - Intronic
1105895622 13:24715188-24715210 TTGAAGACAATTAATAAAAGAGG + Intergenic
1106601759 13:31194303-31194325 AATGAGGCAATTAACTAAAACGG - Intergenic
1106607623 13:31244659-31244681 TTAAAGGTAATTATCAAAAAGGG - Intronic
1106697701 13:32194515-32194537 TTCCAGGCAATTAAAAAGAAAGG - Intronic
1107721644 13:43254530-43254552 TTTAAAGCAATTTATAAATAGGG - Intronic
1108172502 13:47756374-47756396 TTTCAGGCAAAAAAAAAAAAAGG + Intergenic
1108305949 13:49132762-49132784 TTAAAGGAAATTTACAGAAAAGG - Intronic
1108456008 13:50614467-50614489 TTTAAGACAATTGAGAAAACTGG - Intronic
1108980677 13:56509045-56509067 TTAAAGGAAATTAAGAAAATGGG - Intergenic
1109020519 13:57084934-57084956 TTTAATGCACATAATAAAAAAGG + Intergenic
1109257897 13:60105841-60105863 CTTAAGAGAATTAACACAAAGGG + Intronic
1109443526 13:62405005-62405027 TTAAAGGCAATTAACACATTTGG + Intergenic
1109561048 13:64050724-64050746 TTTAAGCCAAATAGCAAAAGTGG + Intergenic
1109564416 13:64093061-64093083 TTTATGTCAATTTACCAAAAAGG + Intergenic
1109629206 13:65022041-65022063 TTTATGGCTTTTAACACAAAGGG + Intergenic
1109801497 13:67384064-67384086 TAAAAGGCAAACAACAAAAAGGG + Intergenic
1109974196 13:69809291-69809313 TTGAAGGCAACTAAGAAAAAGGG + Intronic
1110107848 13:71701229-71701251 TTGAAGTCAATAAACATAAATGG + Intronic
1110334976 13:74317381-74317403 AGTATGGCAATTACCAAAAAGGG - Intergenic
1111324058 13:86668286-86668308 TATCAGGAAATTAACAAGAATGG - Intergenic
1111451708 13:88427685-88427707 TTAAATGCAATTAATAAAATAGG - Intergenic
1111517963 13:89360069-89360091 TTTAAGGGAAGAAGCAAAAAAGG + Intergenic
1111628847 13:90824400-90824422 TTTAAGGAAATAAACATGAACGG + Intergenic
1111901429 13:94204222-94204244 TTTAAGCTGATAAACAAAAAGGG + Intronic
1111920402 13:94403950-94403972 ATTAAGGGAATTAAGAATAATGG - Exonic
1112961473 13:105132592-105132614 CTTAAGTCAATTCACAAAACTGG - Intergenic
1112971104 13:105263994-105264016 TTTAAGGGAAAAAACATAAATGG + Intergenic
1113844204 13:113376549-113376571 ATGAAGGCAATTAACAAATCTGG - Intergenic
1114574982 14:23704713-23704735 TTTAAAGCCAGTTACAAAAAAGG + Intergenic
1114873973 14:26692388-26692410 GTTAAGGCAATTAAAAAACATGG + Intergenic
1115022534 14:28700126-28700148 TTCAAGGAAAGTGACAAAAATGG - Intergenic
1115523507 14:34256487-34256509 TTTAAGGAAATGAAGAAACAAGG - Intronic
1115560788 14:34580981-34581003 TTAAAGGCAATAACAAAAAATGG + Intronic
1116007687 14:39313334-39313356 TTTAAGGAAATTAACAGTAGAGG + Exonic
1116356931 14:43941000-43941022 TTTAAGATAATTTTCAAAAATGG - Intergenic
1116621429 14:47209050-47209072 GTTAAGGAATTTAAAAAAAAAGG - Intronic
1117280966 14:54240601-54240623 TTTAAAACATTAAACAAAAATGG + Intergenic
1117730960 14:58721299-58721321 TGTAAGGCAAAGAAAAAAAAAGG - Intergenic
1117826478 14:59709726-59709748 TTGAAAGCATATAACAAAAATGG + Intronic
1117850298 14:59960975-59960997 TCTAACTCAATTAACAAAAGTGG - Exonic
1118387675 14:65269918-65269940 TGTCAGGCATCTAACAAAAATGG + Intergenic
1119698266 14:76731631-76731653 TTAAAGGCACTTAAAAAACAGGG - Intergenic
1119960802 14:78854379-78854401 TTTTGTGCAATTAAAAAAAAAGG - Intronic
1120140315 14:80923379-80923401 TTTAGGTCAAATAACAAAAGAGG - Intronic
1120286161 14:82504669-82504691 CTTCAGGCCGTTAACAAAAAGGG + Intergenic
1120904061 14:89603774-89603796 TTGAAGGCATTTAACAAACTGGG + Intronic
1121239379 14:92417656-92417678 TTTAGGGCACTTACCACAAATGG - Intronic
1123187013 14:106530056-106530078 TTGGAGGCATTTAAGAAAAAGGG + Intergenic
1123206043 14:106714568-106714590 TTTAAGGCTGTTTACAAAATGGG - Intergenic
1123211128 14:106761978-106762000 TTTAAGGCTGTTTACAAAATGGG - Intergenic
1123700595 15:22912139-22912161 TTGAAGGAAATGAACAGAAATGG + Intronic
1123776481 15:23585471-23585493 TTTAAGGCTACCCACAAAAAGGG - Intronic
1124090782 15:26598244-26598266 TTTAAGCAAAAAAACAAAAAAGG + Intronic
1124185892 15:27528741-27528763 TTAAAAGCAATTCCCAAAAATGG - Intronic
1124986790 15:34625263-34625285 TTAAAGGCAGTTAACTAACAAGG - Intergenic
1125429091 15:39578604-39578626 TTTAAGGCAATCAATTAACATGG - Intergenic
1125847064 15:42865862-42865884 TAGAAAACAATTAACAAAAATGG + Intronic
1126861856 15:52892540-52892562 GTATAGGCACTTAACAAAAATGG + Intergenic
1126921809 15:53535030-53535052 TTTAAGGTAATAAAGGAAAAAGG + Intronic
1127743148 15:61934449-61934471 ATTGAGACAATTAATAAAAATGG + Intronic
1131054979 15:89369700-89369722 TGTTAGGCAAAGAACAAAAAAGG - Intergenic
1131143543 15:89997543-89997565 TTTTACAAAATTAACAAAAATGG - Intergenic
1131662810 15:94536860-94536882 TTTAAAACAATTAAAAATAAGGG + Intergenic
1131843522 15:96464274-96464296 TTTAAGGCATTTAAGAAATGTGG - Intergenic
1132762234 16:1514884-1514906 TTTAAACAAATTAACAAATAGGG + Intronic
1133474943 16:6111849-6111871 TTTAAGTGATTTGACAAAAAGGG + Intronic
1135072091 16:19361086-19361108 TTTAAGACAAGTAAAAAATATGG - Intergenic
1135433114 16:22403995-22404017 TTTAATGCAAATAATAAAATAGG + Intronic
1135854984 16:26001132-26001154 TTTAAGTCAATTTACAATATTGG + Intronic
1135880754 16:26253592-26253614 TTTTAGGCATTTAAAAAAAAAGG + Intergenic
1136313037 16:29428091-29428113 ATTAAGTCAAATAAAAAAAATGG - Intergenic
1136920892 16:34272558-34272580 TTTAAGGCAAATGGCAGAAAAGG + Intergenic
1139189761 16:64848626-64848648 TTTAAGGGAATTAACCAAATTGG - Intergenic
1139324789 16:66144240-66144262 ATAAAGGCAATTGACAAAGAGGG - Intergenic
1139467598 16:67162377-67162399 TGTAAGGCACTTAAAAACAATGG - Intronic
1140169629 16:72590473-72590495 TGAAAGGCATTTAAGAAAAATGG + Intergenic
1140433657 16:74926511-74926533 TTAAAGGCCATTATCAAAACTGG - Intronic
1140591703 16:76361122-76361144 TTTAACACAATTATAAAAAATGG - Intronic
1141133479 16:81450539-81450561 TTCAGGGCAATTAGCAAAACAGG - Intronic
1141303385 16:82838453-82838475 TTTAAGTCAATAAACAGGAAGGG - Intronic
1141629878 16:85281580-85281602 TTAGAGGAAAATAACAAAAATGG - Intergenic
1146781153 17:35673684-35673706 TTTAAGGGAATTACCAATAATGG + Intronic
1146781913 17:35681956-35681978 TTTAATACAATTAAATAAAAGGG - Intronic
1146993746 17:37299130-37299152 TTTAAGAAAATGAATAAAAATGG - Intronic
1148661346 17:49335949-49335971 TTTAAGGCAATATGCAAAAAAGG + Intronic
1148996445 17:51714412-51714434 TTTAAGGCAGTGTATAAAAAGGG + Intronic
1149111503 17:53036828-53036850 TTACAGGCAATTAACTGAAATGG + Intergenic
1151800619 17:76377262-76377284 TTTAGGGTAATTTTCAAAAATGG + Intronic
1153079963 18:1210790-1210812 TGTAAGGCAGTTAACAATTATGG - Intergenic
1153102974 18:1495636-1495658 TTAAAGGCAGTTAGAAAAAAGGG - Intergenic
1153107435 18:1543469-1543491 TTTAAGCCATTGAACAAAGATGG - Intergenic
1155429084 18:25737004-25737026 TTTAAGCCACTAAGCAAAAAGGG - Intergenic
1156761151 18:40592083-40592105 TTAAACTTAATTAACAAAAAAGG - Intergenic
1156770794 18:40721189-40721211 TTAAATGCAATTAAAAATAATGG - Intergenic
1156989360 18:43388631-43388653 TTTAATGATTTTAACAAAAATGG + Intergenic
1157011816 18:43658681-43658703 TTTAGGGCACTTAATAACAAAGG - Intergenic
1158013628 18:52758015-52758037 ATTAAGGAAAATAACAATAATGG + Intronic
1158334302 18:56398807-56398829 TTTAAGGCAAATACTAAAAGAGG + Intergenic
1159585298 18:70278079-70278101 TTTAAAGCAAATAAAGAAAAAGG + Intergenic
1159735095 18:72086302-72086324 TTCAAGGCTGTAAACAAAAAAGG + Intergenic
1160105766 18:75974466-75974488 TTTAAAGCAATTAGAAAGAAGGG + Intergenic
1160157964 18:76447947-76447969 TATAAGGCATTTAAAAAAAGTGG - Intronic
1160166775 18:76520225-76520247 TTTAAGGGAAATAAAAAATAAGG - Intergenic
1162321795 19:9974796-9974818 TGTATGGTAATAAACAAAAAAGG + Intronic
1164657571 19:29935005-29935027 TTTAAAGTAATTACCAATAAAGG + Intronic
1164837400 19:31366028-31366050 TTTGTGGCAATGATCAAAAAGGG - Intergenic
1168537265 19:57181404-57181426 TTAAAGGAAAGTAACAAGAAAGG - Intergenic
1168617579 19:57850868-57850890 TTCAAGGAAATTCACAGAAACGG - Intronic
925080619 2:1061290-1061312 TTTAAGGCAATTAACAAAAATGG + Intronic
925617682 2:5759300-5759322 TTTAATGCAATAAAGGAAAAAGG - Intergenic
926863144 2:17330079-17330101 TTTAATGAAATAAATAAAAAAGG - Intergenic
927626909 2:24731126-24731148 TTCAAGGCAATATACAAATATGG - Intronic
927835144 2:26390763-26390785 ATGATGGCAATTAACAAACATGG - Exonic
928849481 2:35727467-35727489 ATAAAGGCAATTAATGAAAAAGG - Intergenic
930342685 2:50136644-50136666 TTTAAGGCAAAAAGAAAAAAAGG + Intronic
930433285 2:51309066-51309088 TTTAATCCAATTAATTAAAAAGG + Intergenic
930841227 2:55848061-55848083 TTTTAGGCCAGTTACAAAAAAGG + Intergenic
932802847 2:74757335-74757357 TTTTAGGAATTTGACAAAAATGG + Intergenic
932957392 2:76369122-76369144 TTTAAGGCATTTATCACTAAAGG - Intergenic
932976448 2:76606071-76606093 TATAAGCAAATTAATAAAAATGG + Intergenic
933124245 2:78584354-78584376 GATAAGTCAATTAAGAAAAAAGG - Intergenic
933136707 2:78745149-78745171 TTGAAGGCAGATAAGAAAAAAGG - Intergenic
935008781 2:99110578-99110600 TTTAAATCAATTAACAGATAAGG + Intronic
935639045 2:105273287-105273309 TTTAAGGATAATAACAAAGAAGG + Intronic
936883975 2:117286971-117286993 TTGAAGGAAATAAACAATAAAGG + Intergenic
937387102 2:121444964-121444986 TTTAAGCAAATTAAAAAACAAGG + Intronic
937580215 2:123476163-123476185 TATAAGGCACTTACCATAAATGG - Intergenic
938007384 2:127798401-127798423 TTAAAAGCATTTAACAAAATAGG + Intronic
939246776 2:139635277-139635299 TTTTAGGGAATTAAAAATAAAGG + Intergenic
939694663 2:145309755-145309777 TATAAGGCACTTACCATAAATGG - Intergenic
940332526 2:152490730-152490752 TTTAAGGAAAAAAAAAAAAAAGG + Intronic
940597442 2:155813411-155813433 TATAAGGCACTTACCATAAATGG + Intergenic
940963504 2:159812352-159812374 TTTACCACAATTAAAAAAAATGG - Intronic
941158629 2:162009279-162009301 TTTTAGACAATTTTCAAAAATGG - Exonic
941297726 2:163761000-163761022 TTTAAGCCAATTAAACAAACAGG - Intergenic
942236203 2:173908849-173908871 TTTAAGGGAAGAAGCAAAAAAGG + Exonic
942257951 2:174125219-174125241 TTTTAGGCAATGAATAAAAATGG - Intronic
943633868 2:190283661-190283683 TTTATGGCTATTAAAAAAGAGGG + Intronic
944167808 2:196741953-196741975 TTAAAGGGAATGAACAAAACAGG - Intronic
944226403 2:197352903-197352925 TTCAAGGCAAGTGACAGAAAAGG + Intergenic
944360656 2:198851812-198851834 TTTAAGGCCAAAAAGAAAAATGG + Intergenic
944512046 2:200474663-200474685 TTTAAAGAAATTATGAAAAAGGG - Intronic
944543036 2:200772046-200772068 TTTATGGCTATTAAAATAAATGG - Intergenic
944811682 2:203332777-203332799 TTTCAGGGAAGTAACAAATAGGG - Intronic
945381546 2:209146752-209146774 TTTTAGGTAATAACCAAAAATGG - Intergenic
945773803 2:214079711-214079733 AATAAGGCAATTAATAAAATAGG - Intronic
1168938576 20:1689518-1689540 TTTAAGGCAAAAAGCACAAATGG + Intergenic
1168992526 20:2106745-2106767 TTTAAGGCTATCAAACAAAATGG - Intronic
1169576210 20:6964596-6964618 CTTAGGGCAATTGCCAAAAAGGG + Intergenic
1171102755 20:22400883-22400905 TCTAAGGAAATTAACTAAGAAGG - Intergenic
1171169685 20:23004556-23004578 TTCAAGGCATTTAAAAAAATTGG - Intergenic
1171564732 20:26171069-26171091 TTTAAGGCAAAAGACATAAAGGG - Intergenic
1171788026 20:29490700-29490722 ATTAAGGAATTTAAAAAAAATGG + Intergenic
1171922049 20:31106945-31106967 TTAAAAGGAATTAACACAAATGG + Intergenic
1171930541 20:31225051-31225073 TTAAAAGGAATTAACACAAATGG + Intergenic
1172456807 20:35082246-35082268 TTTAACACAATTAAACAAAATGG + Intronic
1173085075 20:39908263-39908285 TATAAGGCAAAAAACAAAGATGG - Intergenic
1174028854 20:47604101-47604123 ATCAAGGTAATTAAGAAAAATGG - Intronic
1174329527 20:49807027-49807049 TTTAAACCAAGAAACAAAAAAGG - Intergenic
1174618595 20:51856159-51856181 TTCAAGGCATTGAAAAAAAAAGG - Intergenic
1174876488 20:54232006-54232028 TTTACAGCATTTAAGAAAAAGGG - Intergenic
1176636595 21:9249534-9249556 TATATGGCATTTAACTAAAAGGG - Intergenic
1176688651 21:9878541-9878563 TTAAAGGCAGTTAACGACAAGGG - Intergenic
1177194459 21:17888103-17888125 TTTAGGGGAATCAGCAAAAATGG + Intergenic
1177237135 21:18406505-18406527 TAGCAGGCAATTGACAAAAAGGG + Intronic
1177295823 21:19174104-19174126 CTTAAGGCATCTCACAAAAAGGG + Intergenic
1177910227 21:27022005-27022027 TTTTAAGCAATTCACAAAGAAGG - Intergenic
1178205680 21:30462096-30462118 TTTATGGCCATTAACAAATATGG + Intergenic
1178698477 21:34814389-34814411 TTTAAGGCCATTAGAAGAAAAGG - Intronic
1178997530 21:37417736-37417758 TTTAAGACAACTAAAAAAAATGG + Intronic
1179356163 21:40662571-40662593 TTGAAGGCAATTAATGAGAATGG + Intronic
1180928050 22:19569884-19569906 TTTAAGTGAAGTAACAATAACGG + Intergenic
1185048411 22:48540595-48540617 TTTGAGGCAAAAAAAAAAAAAGG - Intronic
1185369176 22:50452385-50452407 TTTAAGGAAATTAAGAAAGAAGG - Intronic
949149373 3:746495-746517 TTTCAAGGAATTAATAAAAACGG + Intergenic
949258095 3:2074036-2074058 TTAAAGGAAAATAACAAAATCGG + Intergenic
949581893 3:5396881-5396903 TTTTAGGCACTGAACAAAATGGG - Intergenic
949977774 3:9476546-9476568 TTTTATGCACTTAAGAAAAAAGG + Exonic
950347523 3:12310766-12310788 TTTAAGGCAACTATTAAAAAGGG - Intronic
950608387 3:14106168-14106190 TTTAAGTCAATTATCAAATATGG + Intergenic
950844777 3:16004241-16004263 TTTTGGGTAATTAACAAAATGGG + Intergenic
951163203 3:19452012-19452034 TAAAAGGCAGTTGACAAAAATGG + Intronic
951275004 3:20674386-20674408 TTTTAGGCAATAAAAATAAATGG - Intergenic
951602665 3:24393849-24393871 TAAAAGGCCATTAGCAAAAATGG - Intronic
952442535 3:33346614-33346636 ATTAAGGAAATTAATAACAATGG + Intronic
954047000 3:47940587-47940609 TTGAAGGCATTTAACAGAAAAGG + Intronic
955265771 3:57443051-57443073 TTTAACGCAATTAATGAAATAGG - Intronic
955369779 3:58340972-58340994 TTTAAGGAAAAAAAAAAAAAAGG - Intronic
955479952 3:59379824-59379846 TTGATTGCAAGTAACAAAAATGG + Intergenic
955718085 3:61852125-61852147 TAAAAAGAAATTAACAAAAATGG - Intronic
956711375 3:72041379-72041401 TTTAAGAGAATTGACAAGAATGG + Intergenic
957191431 3:77015164-77015186 TTAAAATCAATTAACCAAAAAGG + Intronic
957225634 3:77441772-77441794 TTTAAGCTAATTCACCAAAATGG - Intronic
957228130 3:77475317-77475339 CTTATGGCATTCAACAAAAAGGG - Intronic
957488037 3:80888355-80888377 ATTAATGCAAGAAACAAAAAAGG - Intergenic
957590273 3:82187991-82188013 ATTAAAGAAATTAATAAAAAAGG - Intergenic
957972143 3:87396139-87396161 TTGAATGCAAGCAACAAAAAAGG + Intergenic
958214266 3:90542047-90542069 TTTAAGGCCATTGATAGAAAAGG - Intergenic
958648574 3:96905125-96905147 TTTAAGAGAACTAAGAAAAATGG + Intronic
959167871 3:102803065-102803087 TTTTAGGCAATTTTGAAAAAAGG - Intergenic
959386327 3:105713097-105713119 TTAAAGTAAATTAACAAAGATGG - Intronic
959954697 3:112222493-112222515 TTTGAGGCAATAAATCAAAAAGG + Intronic
960607308 3:119520377-119520399 ATTAAGGTAAAAAACAAAAAAGG + Intronic
960742360 3:120848989-120849011 TTTTGCCCAATTAACAAAAATGG - Intergenic
961399856 3:126631863-126631885 TTCAAGGCAACCAATAAAAAAGG - Intronic
962554870 3:136538261-136538283 TTTAATACAATAAACAAACAAGG + Intronic
963030130 3:140962228-140962250 TTTAATGTACTTAAGAAAAAAGG - Intronic
963593554 3:147295960-147295982 ATTAAGGCAATTTACAAAGTTGG - Intergenic
963669566 3:148234636-148234658 ATTCAGACAGTTAACAAAAAAGG + Intergenic
965829569 3:172769344-172769366 TTTAAAGTAATTATTAAAAATGG - Intronic
966510289 3:180754772-180754794 ATTAAGGGAATGAACAAAAAAGG + Intronic
967301071 3:188013027-188013049 TTCAAATCAATGAACAAAAATGG + Intergenic
969710976 4:8843302-8843324 TTTCAGGCAATTAATAACAATGG - Intergenic
970100713 4:12518431-12518453 ATTAAAGCAAGGAACAAAAAGGG + Intergenic
970845822 4:20536140-20536162 TGTAGGGCACTTAACAAGAATGG + Intronic
971045517 4:22801264-22801286 TTCAAAGTAATTAAGAAAAATGG - Intergenic
971251229 4:24975014-24975036 TTTAATCCCATTAACAAAGAAGG - Intronic
971306289 4:25484838-25484860 ATTAAAGCAATGAACAAAGATGG - Intergenic
971941975 4:33227225-33227247 TTTTTGGCATTTAAAAAAAATGG + Intergenic
971986419 4:33830495-33830517 TTTAAGGCAAAAGACATAAAGGG + Intergenic
972010327 4:34171754-34171776 ACTAATGTAATTAACAAAAATGG + Intergenic
972124743 4:35749438-35749460 TTAAAGGCAATTAACAGAAATGG - Intergenic
972210787 4:36834325-36834347 CTTAAGGAAAATAAAAAAAAAGG + Intergenic
972230720 4:37069848-37069870 GTAAAGCCAATTAACAAACACGG - Intergenic
972398389 4:38676806-38676828 TTTAAGTTAATAAACAAAGAAGG - Intronic
972470835 4:39402698-39402720 TTAAAGGCAAATAACAAACTTGG - Intergenic
972769676 4:42185454-42185476 TATAAAGCAATTACCAAAACTGG - Intergenic
972846067 4:42991323-42991345 TTTAAGACAATAAATATAAATGG - Intronic
973933825 4:55821075-55821097 TCTAAGTCAATTACCAGAAAGGG - Intergenic
974405875 4:61468706-61468728 TTTAATGGACTTAATAAAAAAGG + Intronic
974563264 4:63550425-63550447 TTTGCAGCAATTAACCAAAAAGG - Intergenic
974574218 4:63696989-63697011 TAAAAAGCAATTAACCAAAATGG + Intergenic
974667321 4:64980957-64980979 TTTAGGGCACTTACCATAAATGG - Intergenic
974777788 4:66509452-66509474 TTAAAAGCAAATAACAAATAAGG + Intergenic
975341189 4:73242935-73242957 GTTAAGGCAAAAAACTAAAAGGG + Intronic
975613571 4:76224263-76224285 ATAAAGGCAATTAACACAGATGG - Intronic
975666517 4:76739844-76739866 TTTCAGGCACTGAACAGAAATGG - Exonic
975672410 4:76794670-76794692 ATTAAGGCATTTAAAATAAATGG + Intergenic
975882327 4:78925188-78925210 TTTAGAGAAATTAAGAAAAAGGG - Intronic
976103150 4:81587127-81587149 TATAATGCATTTACCAAAAAGGG + Intronic
976319236 4:83692608-83692630 TTTATGAGAATTAAAAAAAAAGG + Intergenic
976365252 4:84226316-84226338 CCTAAGGCAATTATCAGAAATGG - Intergenic
977415775 4:96731428-96731450 TTAATGTCAATTGACAAAAATGG + Intergenic
977646566 4:99419231-99419253 TTTAAAGCAAGTAAAAAACAAGG - Intronic
978389993 4:108215456-108215478 ATTATGGCACTTAACAAATAAGG + Intergenic
978672109 4:111262036-111262058 ATTGATGCAATTAACAAAAAAGG + Intergenic
979659245 4:123234343-123234365 TTATAGTCAATTTACAAAAAGGG - Intronic
980073012 4:128263650-128263672 TTTTAGGAAATTACAAAAAATGG - Intergenic
980314034 4:131173386-131173408 ATTATGGCATTTAAGAAAAAAGG - Intergenic
980352041 4:131696342-131696364 TTAAAGGCAGTTAACGACAAGGG - Intergenic
981166361 4:141563214-141563236 TTTAAGGGAATTAAAAGTAATGG - Intergenic
981268715 4:142818953-142818975 TATAAGGCAATAAACCAAATTGG - Intronic
981369185 4:143939019-143939041 TTTGAGGCTATTAAGAATAACGG + Intergenic
981378927 4:144048953-144048975 TTTGAGGCTATTAAGAATAACGG + Intergenic
981647417 4:147016415-147016437 TTTATAGGAATTAACCAAAAAGG - Intergenic
981898245 4:149830617-149830639 TTTATGGCTATGAACATAAAAGG - Intergenic
982337152 4:154253022-154253044 TTTAAGGCAATAAGAAATAAAGG - Intronic
982729739 4:158943570-158943592 TTTTTGGCTATTAAAAAAAATGG - Intronic
982868624 4:160549257-160549279 TTTGTGGCACTTAAAAAAAATGG + Intergenic
983164238 4:164455222-164455244 TTTAAGACAATAAACCAAACTGG + Intergenic
983431209 4:167653398-167653420 TTGAATGCAAATAACATAAAAGG - Intergenic
983859092 4:172682266-172682288 TTTAACACAGTTTACAAAAATGG + Intronic
984013095 4:174394421-174394443 AATTAGGCAATTAAAAAAAAAGG - Intergenic
984583058 4:181532897-181532919 TTTAAGAAAATCATCAAAAAGGG - Intergenic
984771538 4:183440914-183440936 TTGAAGGCAACTCACAGAAAAGG - Intergenic
985087653 4:186329836-186329858 TTATAGGCTATTATCAAAAAGGG - Intergenic
1202751483 4_GL000008v2_random:7973-7995 TATATGGCATTTAACTAAAAGGG - Intergenic
985859765 5:2461725-2461747 TTTAAGTCAATAATCAAAGAAGG - Intergenic
986551889 5:8966113-8966135 TTTAGCACAATTAAAAAAAAAGG + Intergenic
987358271 5:17083813-17083835 TTAAAGGCAACTACCAAAATTGG + Intronic
987523159 5:19013798-19013820 TTTAAGGTAATTATAAAAATTGG + Intergenic
987583722 5:19827104-19827126 TTTAAACCAATGAACAAAAAAGG + Intronic
987669871 5:20992350-20992372 TTAAAGGCAGATAGCAAAAAAGG + Intergenic
988039365 5:25869652-25869674 CGTAAGGAAATTAACAAACAAGG - Intergenic
988263257 5:28918135-28918157 TTTAAGACAATTAACAATCAGGG + Intergenic
988356451 5:30182603-30182625 TTTAAGACAATAAAGACAAAAGG - Intergenic
988758353 5:34285162-34285184 ATTAAGACACTTAAAAAAAAAGG - Intergenic
989096033 5:37782085-37782107 TTTTAGGAAATTACAAAAAATGG + Intergenic
989119383 5:37989326-37989348 TTTATGGCAACTCAGAAAAAGGG - Intergenic
989705010 5:44319406-44319428 TTTAAGGAAAATAATAAAATGGG + Intronic
989941398 5:50155728-50155750 TTTAAGGCCAATAACTGAAAAGG - Intergenic
990080966 5:51913171-51913193 TTTAAGATAATGAACAACAAAGG + Intergenic
990413223 5:55561732-55561754 TTTAAGGCAATTCTTAAACATGG + Intergenic
991015284 5:61925632-61925654 GTGAAGGGAATTAAGAAAAAGGG - Intergenic
991262440 5:64681414-64681436 TTTAAAACAATTAACAATTAAGG + Intergenic
991369718 5:65905341-65905363 TGTGAGACATTTAACAAAAAAGG - Intergenic
992061353 5:73051174-73051196 TTGAAGCTAATTAACTAAAAAGG + Intronic
993042497 5:82831005-82831027 TTTAAGGAAAATATCAAAATTGG + Intergenic
993178342 5:84517408-84517430 TTAAAGGCAACTAGAAAAAAAGG - Intergenic
993427878 5:87792429-87792451 CTAAAGGCAATTATCAAAAGAGG + Intergenic
993494586 5:88593552-88593574 TCTAAGGCAAATAACAAAACAGG + Intergenic
993834886 5:92806896-92806918 TTTTATGCAATTAACAAGCAGGG + Intergenic
994030801 5:95140320-95140342 TTTAAGGCAATTAGTAACACGGG + Intronic
994449443 5:99923495-99923517 TTTAAGGAAATGAAGAAATACGG - Intergenic
994811997 5:104531652-104531674 TTTTAGGCAATTAACATACAAGG + Intergenic
994834047 5:104826026-104826048 TTTAAAGAAATTAATAATAATGG - Intergenic
994884648 5:105544123-105544145 TTTAAAGCAATCAATAAAGAAGG - Intergenic
994902387 5:105791727-105791749 TCTGATGCAATTACCAAAAAAGG + Intergenic
995488738 5:112666982-112667004 TGTAAGGCACTTACCACAAATGG + Intergenic
996448122 5:123582700-123582722 TTTAAAGCACTTAACTACAAAGG - Intronic
996515745 5:124367285-124367307 TTAAAGGCATTTAATATAAATGG + Intergenic
996888806 5:128392618-128392640 CTTAAGCAATTTAACAAAAAAGG + Intronic
997479551 5:134174013-134174035 TTGAAGGCATCTAAAAAAAAAGG + Exonic
997912323 5:137888614-137888636 TTTCAGGGAAATAACAAAAGTGG + Intronic
998434285 5:142094256-142094278 TTTAAGGAAATAATCAAAGATGG + Intergenic
999013522 5:148070338-148070360 TTTCAGGCATTTATGAAAAATGG + Exonic
1000756784 5:165171136-165171158 TTTAGGGAATTTAACAAAAATGG - Intergenic
1001271362 5:170314639-170314661 TTTAAGGAAATTAACTCATATGG - Intergenic
1001347430 5:170918073-170918095 TTAAAAGGAAGTAACAAAAAAGG - Intronic
1001659069 5:173376963-173376985 TTTAATGCCAATGACAAAAATGG + Intergenic
1002567982 5:180123385-180123407 TTTGAAGCAATAAACAAACACGG + Intronic
1002929421 6:1623235-1623257 TATTAGGCACTTAACATAAATGG + Intergenic
1003802796 6:9689718-9689740 TAAAAGGCAATTCACAGAAAAGG + Intronic
1003945745 6:11073821-11073843 TTCAAGGCAATGAATTAAAAAGG + Intergenic
1004979226 6:21003973-21003995 TTAAAGGCACATTACAAAAAAGG - Intronic
1005042717 6:21613750-21613772 TTTAAGCAAACAAACAAAAATGG + Intergenic
1005131596 6:22515113-22515135 TTCAAGTCAATTAAAAAATAAGG + Intergenic
1005265089 6:24103738-24103760 TTCCAGGCAATTCACAATAAAGG + Intergenic
1007303396 6:40885767-40885789 TATAAGGCAATCAAAAAAACTGG + Intergenic
1008071726 6:47105310-47105332 TTTAAGGCATTAGCCAAAAATGG - Intergenic
1008135183 6:47767643-47767665 TTTAAGAAAATAAACATAAAGGG - Intergenic
1008300873 6:49837830-49837852 TCTAAGGGAATAAACAGAAATGG + Intronic
1008344677 6:50412003-50412025 TTTAAGGAAAAAAAAAAAAATGG + Intergenic
1009581815 6:65545718-65545740 TTAAAAGCAATGAACAAACATGG + Intronic
1009629717 6:66179785-66179807 TTTAAGCTACTAAACAAAAATGG + Intergenic
1009737339 6:67693336-67693358 TTTAAATCAATCAATAAAAATGG + Intergenic
1010569148 6:77456801-77456823 TTTAAAGCATTTACCATAAATGG + Intergenic
1011104199 6:83760849-83760871 GGTAAGGCAATTAAAAACAATGG + Intergenic
1011204953 6:84881879-84881901 TTTAAGTTAATTAAAAAATAGGG + Intergenic
1011438920 6:87367624-87367646 TCTAAGACAACTAAGAAAAATGG - Intronic
1011636773 6:89382010-89382032 TTTATGGCAAAAAAAAAAAAAGG + Intronic
1011709529 6:90038157-90038179 TTTAAAACAATTACCAAAAAGGG - Intronic
1012031740 6:94077322-94077344 TTTAAGCCCATCAACATAAAAGG + Intergenic
1012057811 6:94437206-94437228 TATTAGGCAAGTGACAAAAATGG - Intergenic
1012065060 6:94539181-94539203 ATTAAGGGAATCAACAAAAGCGG + Intergenic
1012711886 6:102617313-102617335 TTTAAGAGATTTAACAAACATGG - Intergenic
1012980504 6:105825150-105825172 TTTAGCTCAATTAAAAAAAAAGG - Intergenic
1013995737 6:116305540-116305562 ATTAAGGCAATTGACAAAATTGG + Intronic
1015043744 6:128754150-128754172 TATAGGGCAATTACCATAAATGG - Intergenic
1015294263 6:131572658-131572680 TTTAAAGTAATCATCAAAAAAGG + Intergenic
1015318098 6:131840383-131840405 TTTATGGCATTTAAGAAAATAGG + Intronic
1015343126 6:132125302-132125324 TTAAGGGCAAATGACAAAAAGGG + Intergenic
1015414195 6:132930121-132930143 TCTAAGGCATTGAACAAAAGAGG - Intergenic
1015442545 6:133265047-133265069 TTTAAGACAATTCTCAGAAATGG - Intronic
1016260952 6:142170190-142170212 TTTCAAGAAAATAACAAAAATGG - Intronic
1016605501 6:145918790-145918812 CTTAAGGCACTAAACAAATAAGG + Intronic
1017234619 6:152106236-152106258 TTTAAGGCAATAAAATAACATGG - Intronic
1017859994 6:158387898-158387920 TTGAAGGCAAGTCACTAAAAAGG - Intronic
1018306052 6:162457104-162457126 TTTAAGGTCATTCACAGAAATGG - Intronic
1018333892 6:162763518-162763540 TTTAAGGTAATATTCAAAAAGGG - Intronic
1018418697 6:163623275-163623297 TTTAGGGCAACTTACAATAAAGG + Intergenic
1018593983 6:165458590-165458612 GCTAAGGCAAATAAGAAAAATGG - Intronic
1020340011 7:7100005-7100027 TTTATTACATTTAACAAAAATGG + Intergenic
1020422080 7:8018709-8018731 TGTAAGACTATTAACAAAAAAGG - Intronic
1020979139 7:15046124-15046146 TTTGAGGCAATTAAAACAATTGG + Intergenic
1021082223 7:16378090-16378112 TTTAAAAAAATTAAAAAAAAAGG - Intronic
1021351616 7:19601215-19601237 TTAAAGGCAACTAAAGAAAAAGG - Intergenic
1022165605 7:27758008-27758030 CTAAAGGGAAATAACAAAAAAGG - Intronic
1022241016 7:28512568-28512590 TTTAAGTCATTAAACATAAAAGG - Intronic
1022332080 7:29389588-29389610 TTTAAGGATATTCACAAGAAAGG + Intronic
1022681846 7:32555818-32555840 TTTAAGGTAATGAACTAAAGTGG - Intronic
1024960943 7:54975444-54975466 GTATAGGCAATTAAGAAAAAAGG + Intergenic
1025273055 7:57543463-57543485 TTTAAGGCAAAAGACATAAAGGG + Intergenic
1026147220 7:67757712-67757734 TATAGGGCAATTACCATAAATGG - Intergenic
1027891459 7:83981602-83981624 TTTAAAGAAATTAGCAATAAAGG - Intronic
1028299327 7:89178039-89178061 TTCAAGACAACAAACAAAAAAGG - Intronic
1028439391 7:90841543-90841565 TTATGGGCAACTAACAAAAAAGG - Intronic
1028816308 7:95149904-95149926 TTTAAGGGAAATAACAAAGTTGG + Intronic
1028946764 7:96588913-96588935 TATAAGCCAATTTAAAAAAATGG - Intronic
1029911627 7:104157663-104157685 TATATGGCAATTAAAAACAATGG - Intronic
1029933177 7:104395209-104395231 TTTAACACAATTAACAAACAAGG + Intronic
1030519548 7:110581145-110581167 CTTCAGGCATTTAACAAGAATGG + Intergenic
1030976767 7:116134675-116134697 CTTAATGCAGTTATCAAAAAAGG - Intronic
1031715247 7:125101241-125101263 TTTATGGCAAATTACAAATAAGG + Intergenic
1032375050 7:131405201-131405223 TTCAAGATAAGTAACAAAAAAGG - Intronic
1032375057 7:131405329-131405351 TTCAAGATAAGTAACAAAAAAGG - Intronic
1032767498 7:135011978-135012000 TTTGGGGCTATTAAGAAAAATGG - Intronic
1032873044 7:136006835-136006857 TTTAAGGGAATTGTCAAAAGTGG + Intergenic
1032918603 7:136520246-136520268 TGTAAGGCAATAAGCAAAACAGG - Intergenic
1033110970 7:138575817-138575839 CTTAAGGCAATAAACAAAAGAGG - Intronic
1033427530 7:141257965-141257987 TTTAAAGCAAATAAATAAAATGG - Intronic
1033518791 7:142138709-142138731 TTTAATGCAAAAAATAAAAATGG - Intronic
1034023248 7:147668927-147668949 TATAGGGCACTTAACAAAAATGG - Intronic
1034153189 7:148933166-148933188 TTAAAGGCAAGCAACAAACAAGG + Intergenic
1034371008 7:150596940-150596962 TTTAAATCAGTTAACAAAAGGGG - Intergenic
1034582197 7:152054434-152054456 TTTACCACAATTAAAAAAAATGG - Intronic
1034606034 7:152316394-152316416 TCTAAGTCTATTAATAAAAAAGG + Intronic
1035689796 8:1552546-1552568 TTTAATGCAATTGACAGGAAGGG - Intronic
1036126344 8:6066363-6066385 TTAAAGCCAATTAGCAAAGATGG - Intergenic
1037259609 8:16993190-16993212 TTTGTGGCACTTAACAAAGACGG - Exonic
1037338035 8:17811098-17811120 TTGAAGGAAAGTAATAAAAAGGG - Intergenic
1037464475 8:19146542-19146564 TGAAAGGCAATTCACAGAAAAGG + Intergenic
1039372283 8:36997464-36997486 TTTAAAGAAATTAAAGAAAATGG + Intergenic
1039422646 8:37456406-37456428 TTTAAGGAAATAAATAAAAAAGG + Intergenic
1040705797 8:50125416-50125438 TTTAAAGAAACAAACAAAAATGG - Intronic
1040845754 8:51837350-51837372 TTTAAGACAATATTCAAAAAGGG + Intronic
1041230207 8:55742744-55742766 TTTATTGCATTTAACAAGAATGG + Intronic
1041561012 8:59217144-59217166 TTTAAGAAAATGAACAAAAGGGG - Intergenic
1041961914 8:63627609-63627631 TTTCAGGCATTTAATTAAAATGG + Intergenic
1041991677 8:64000081-64000103 TTAAAGGAAAGTAAAAAAAATGG + Intergenic
1042108480 8:65354494-65354516 TTAAAGGCAGCTAGCAAAAAAGG - Intergenic
1042215265 8:66424869-66424891 TTTAAGGAAACTGACAATAACGG + Intergenic
1042221627 8:66479932-66479954 TTTAAGGGATTTAAAAAGAAAGG - Intronic
1042347556 8:67743233-67743255 TTTAATGTAGTTAACAAAAAAGG + Intronic
1042567075 8:70122704-70122726 TTTAAAACGATTAATAAAAATGG - Intronic
1042594425 8:70430672-70430694 TTTCACTCAATTAAAAAAAATGG + Intergenic
1042732520 8:71952930-71952952 TATAAGGAAATTAAAAAACATGG + Intronic
1043064133 8:75544763-75544785 ATATAGGCTATTAACAAAAATGG + Intronic
1043092381 8:75922034-75922056 GTTAAGCCAAGTAACTAAAATGG - Intergenic
1043850284 8:85208532-85208554 TTGAAAGCAATAACCAAAAAAGG + Intronic
1044124760 8:88444607-88444629 TTAAAGCCAATTAACAAAACAGG + Intergenic
1044191707 8:89326739-89326761 TTTAAGGTAATGAAGAAAATAGG - Intergenic
1044365810 8:91343786-91343808 TTAAAGGAAGTTAACAAAAATGG - Intronic
1044494773 8:92863879-92863901 TTCAAGCCAATTACCAGAAAGGG + Intergenic
1044516885 8:93149416-93149438 TTACAGGCACTTAACAAAAGTGG - Intronic
1045066042 8:98445600-98445622 ATTAAGGCAATTTACAAAGAAGG - Intronic
1045301600 8:100915808-100915830 TTTAAGCCAAAAAAAAAAAAGGG - Intergenic
1045603144 8:103741649-103741671 TTTAAGTCAATATACTAAAAAGG + Intronic
1046010106 8:108536011-108536033 TTTAATGCCATAAATAAAAAAGG - Intergenic
1046225677 8:111276070-111276092 TTTAACACAATTGATAAAAAGGG - Intergenic
1046258884 8:111739979-111740001 TTTAGGTAAATTAACAGAAATGG - Intergenic
1046857785 8:119053663-119053685 TTGTAGGCAATTAAAAAAAAAGG + Intronic
1046971272 8:120226265-120226287 CTTGAGGAAATTAACAAAATAGG - Intronic
1047031194 8:120883068-120883090 TTTCAGACTATTAACACAAAGGG - Intergenic
1048245611 8:132794796-132794818 ATTGAAGCAATTAACAAAGAAGG + Exonic
1049032275 8:140046754-140046776 TTTAGGGCAATTATAAAATATGG - Intronic
1050224407 9:3435060-3435082 TATTAGGCACTTAACAGAAATGG + Intronic
1050318797 9:4429906-4429928 TTTTAGGCATTTTATAAAAAAGG + Intergenic
1050327976 9:4516093-4516115 TTTATGGCAACTCACAAAAGAGG - Intronic
1050990504 9:12145499-12145521 TTTAACCCATTTAACAAAATAGG - Intergenic
1051816362 9:21111399-21111421 TTTAAATTACTTAACAAAAATGG - Intergenic
1053112094 9:35470032-35470054 TTTTTGGCAATAAAAAAAAAAGG + Intergenic
1053449379 9:38180374-38180396 TGTAAAGCAATTAGCAATAATGG - Intergenic
1053780675 9:41603355-41603377 TTAAAGGCAGTTAACGACAAGGG + Intergenic
1054168619 9:61813512-61813534 TTAAAGGCAGTTAACGACAAGGG + Intergenic
1054668912 9:67767299-67767321 TTAAAGGCAGTTAACGACAAGGG - Intergenic
1054995067 9:71377341-71377363 TTTCAGGCATTTTACAAGAAGGG + Intronic
1055319282 9:75066383-75066405 TTTAAGGGAATAAAAGAAAAGGG + Intronic
1055358929 9:75468045-75468067 TTGAAAGCAATGAACAAACATGG - Intergenic
1055546661 9:77381677-77381699 TATAATGCTATAAACAAAAAGGG - Intronic
1056083712 9:83123782-83123804 GTTACTGCAATAAACAAAAAAGG - Intergenic
1056371909 9:85964474-85964496 ATTGGGTCAATTAACAAAAATGG - Intronic
1056414407 9:86362449-86362471 TTTAAGGAAATTACAAAAACCGG + Intergenic
1058021721 9:100097353-100097375 TTTTAGGAAATCAAAAAAAAAGG - Intronic
1058660606 9:107264357-107264379 CTTAAGGCAATTAACAAACTAGG - Intergenic
1059581895 9:115558017-115558039 TTTAAGAGAAGTAATAAAAATGG - Intergenic
1203718940 Un_KI270742v1:185578-185600 TATATGGCATTTAACTAAAAGGG + Intergenic
1203653174 Un_KI270751v1:149253-149275 TATATGGCATTTAACTAAAAGGG + Intergenic
1186381613 X:9066726-9066748 TTGAAAGCAATTAAAAAAATTGG - Intronic
1187458294 X:19462334-19462356 ATGATGGCAATTAACAAAAAAGG - Intronic
1187640133 X:21278489-21278511 TTTAAGGCAATTAAAAAGGTGGG + Intergenic
1188693786 X:33162521-33162543 TTAATGGGAATTGACAAAAAGGG + Intronic
1188978811 X:36707587-36707609 TTTAAGACTATTAACAAAGCTGG + Intergenic
1188995968 X:36886382-36886404 TATAGTACAATTAACAAAAATGG - Intergenic
1189866088 X:45328775-45328797 TTTGAGGCTATTATCAATAAAGG + Intergenic
1189887038 X:45557812-45557834 TTAATGGAAATTAACAAATATGG - Intergenic
1189944740 X:46166540-46166562 TTTAATGCATATAACCAAAATGG - Intergenic
1190198585 X:48341286-48341308 TATAAAACAATTAACAAAAGGGG + Intergenic
1190618119 X:52259249-52259271 CTTAGGGCTATTAACAAAAAAGG + Intergenic
1190665352 X:52691697-52691719 TATAAAACAATTAACAAAAGGGG + Intronic
1190674070 X:52766722-52766744 TATAAAACAATTAACAAAAGGGG - Intronic
1190693373 X:52931222-52931244 CTTAGGGCCATTAACAAAAAAGG + Intronic
1192551271 X:72055721-72055743 TTCATGGCAGATAACAAAAAGGG + Intergenic
1192594423 X:72391533-72391555 TTTAAGGCAATGACAAGAAAAGG - Intronic
1193455492 X:81726531-81726553 TTGAAGCCAATTAAAGAAAAAGG + Intergenic
1193650040 X:84120426-84120448 TTGAAGGCTTTGAACAAAAATGG - Intronic
1193652801 X:84159217-84159239 TTTTAGGCAATAGACAAGAATGG - Intronic
1193725949 X:85039668-85039690 TTTAAACCAATGATCAAAAAAGG - Intronic
1193795903 X:85872923-85872945 TTTAGGGCAAATTACAGAAATGG + Intronic
1194154616 X:90371760-90371782 TATAAGGCAAAAAAAAAAAAGGG - Intergenic
1194734390 X:97494945-97494967 TTCAGGGCAATTAAGAACAAAGG - Intronic
1196254937 X:113506135-113506157 TTTAATGCAATTGACAAACATGG + Intergenic
1196427434 X:115585801-115585823 TTTAAAGCAAATCTCAAAAAAGG - Intronic
1197618855 X:128723899-128723921 TTTAAGTCAAAAAACAAAAAAGG + Intergenic
1197852524 X:130878350-130878372 TGTGAGGCATTTAACAAGAAGGG - Intronic
1197877881 X:131130136-131130158 TTAAAGACAATTAAAATAAATGG - Intergenic
1198147191 X:133868929-133868951 TTTAGGGCTAATAACTAAAAGGG + Intronic
1198579794 X:138050591-138050613 TTAAAGGCAGCTAAAAAAAAAGG + Intergenic
1198632189 X:138652746-138652768 TGAAAGGCTATTCACAAAAAAGG + Intronic
1198752271 X:139947877-139947899 TTCAAGGCAATATTCAAAAATGG + Intergenic
1200500969 Y:3948646-3948668 TATAAGGCAAAAAAAAAAAAGGG - Intergenic
1200735031 Y:6784926-6784948 TGTATGGGAATTAACATAAATGG + Intergenic
1201786160 Y:17781899-17781921 TGTAAATAAATTAACAAAAAAGG - Intergenic
1201815393 Y:18124089-18124111 TGTAAATAAATTAACAAAAAAGG + Intergenic
1202339491 Y:23847332-23847354 TTTCAGGTAATTAAAAAATAGGG + Intergenic
1202531275 Y:25822736-25822758 TTTCAGGTAATTAAAAAATAGGG - Intergenic