ID: 925082165

View in Genome Browser
Species Human (GRCh38)
Location 2:1078843-1078865
Sequence CTGAGGGTCAGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1516
Summary {0: 1, 1: 0, 2: 15, 3: 157, 4: 1343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925082153_925082165 25 Left 925082153 2:1078795-1078817 CCAGGCAGAGGGAGAGACATTTC 0: 1
1: 0
2: 2
3: 26
4: 313
Right 925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG 0: 1
1: 0
2: 15
3: 157
4: 1343
925082152_925082165 26 Left 925082152 2:1078794-1078816 CCCAGGCAGAGGGAGAGACATTT 0: 1
1: 0
2: 3
3: 46
4: 332
Right 925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG 0: 1
1: 0
2: 15
3: 157
4: 1343
925082151_925082165 27 Left 925082151 2:1078793-1078815 CCCCAGGCAGAGGGAGAGACATT 0: 1
1: 0
2: 2
3: 34
4: 331
Right 925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG 0: 1
1: 0
2: 15
3: 157
4: 1343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925082165 Original CRISPR CTGAGGGTCAGGAGGGAGGA AGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900341565 1:2191850-2191872 CTGCGGGTCACGTGGGTGGATGG - Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900509964 1:3054120-3054142 CTGAGGGTCAGGAGCGAGTGGGG + Intergenic
900572482 1:3365358-3365380 CTGAGGGTCAGGAAGAGGAAAGG + Intronic
900774475 1:4571899-4571921 GAGAAGGGCAGGAGGGAGGAAGG + Intergenic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
900802859 1:4748113-4748135 CTGAAGGTCAGGTGAGGGGATGG - Intronic
900951082 1:5858607-5858629 CTGAGGGTCTGAGGGGAGCAGGG - Intergenic
901089350 1:6631107-6631129 GGGAGGCTCAGGTGGGAGGATGG - Intronic
901143332 1:7049906-7049928 CTGATGTTCTGGTGGGAGGAGGG + Intronic
901230983 1:7641615-7641637 ATGAGGGTCAGGAGGGACAGAGG + Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902036551 1:13462429-13462451 GGGAGGGTAAGGTGGGAGGATGG - Intergenic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902378051 1:16039502-16039524 CTGAGTTGCAGGTGGGAGGATGG - Intergenic
902383140 1:16061998-16062020 CTGAGTTGCAGGTGGGAGGATGG - Intronic
902471114 1:16647986-16648008 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
902487689 1:16759459-16759481 CTGCGGGTGAGACGGGAGGAGGG - Intronic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902784700 1:18725418-18725440 AGGAGGGGCAGGCGGGAGGAAGG - Intronic
902821789 1:18947887-18947909 CTCAGGGTGAGGAGGCAGGCAGG - Intronic
902972374 1:20063089-20063111 TGGAGGGTGAGGTGGGAGGATGG + Intronic
902974547 1:20079613-20079635 GGGAGGCTCAGGTGGGAGGATGG - Intronic
902976452 1:20092154-20092176 ATGGGGGTCAGGTGGGAGGCAGG + Intergenic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903190030 1:21651216-21651238 CTGAGAGCCAGGATGCAGGAAGG + Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
903460608 1:23518064-23518086 AGGAGGGTGAGGTGGGAGGATGG + Intronic
903474994 1:23613411-23613433 CTAGGGGGCAGGAGGGATGAGGG + Intronic
903614199 1:24640413-24640435 CAGAGGTTGAGGTGGGAGGATGG + Intronic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
903721992 1:25412605-25412627 AGGAGGGTGAGGTGGGAGGATGG + Intronic
904009992 1:27383858-27383880 ATGAGGGGCAGAAGGGAGGCGGG - Intergenic
904181634 1:28669849-28669871 TTGAGGGGCAGGAGAGATGAAGG + Intronic
904684683 1:32251501-32251523 CTCAAGGTCAGGTGGGAGGCAGG + Intronic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904807478 1:33142123-33142145 CAGAGGGCTAGGAGGGAGGTGGG - Intergenic
905078671 1:35297368-35297390 CTGAGGGTGAGATGGGAGGATGG + Intronic
905125404 1:35712792-35712814 GGGAGGCTCAGGTGGGAGGATGG + Intergenic
905284217 1:36868820-36868842 CTGAGGGTCTGGTGGAAGGCGGG - Intronic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905658444 1:39701506-39701528 CTCAGGGCCAGGATGAAGGAGGG - Intronic
905972555 1:42153084-42153106 GTGAGGCTCAGGAGGGAGGGTGG - Intergenic
906072835 1:43029624-43029646 AGGAGGGGCAGGAGGGAGGGAGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906390507 1:45411330-45411352 GTGAGGGTCAGGTGGAGGGATGG + Intronic
906501240 1:46342878-46342900 CAGAGAGGCAGGAGGGAGGTGGG - Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906628809 1:47347312-47347334 ATGAGGCTGAGGTGGGAGGATGG - Intronic
906646300 1:47477987-47478009 CTGAGGGTCAGAAAGGGGAAGGG - Intergenic
906677238 1:47701960-47701982 CTGGGGGTCAGGGAGGAGGTTGG - Intergenic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907249118 1:53126268-53126290 GTGAGGGCCACGAGAGAGGAGGG - Intronic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
907852220 1:58266504-58266526 GTGAGGCTCAGCAGGGAGAAAGG - Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908379967 1:63588374-63588396 TTCAGGGGTAGGAGGGAGGAGGG + Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
911824636 1:102466564-102466586 CTAAAGATCAGGAGGGAGGTAGG - Intergenic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912149765 1:106843796-106843818 TTTTGGGTCAGGAGGGAGGCTGG + Intergenic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
912559336 1:110538876-110538898 CTCAGGGGCGGGAGGGAGGGAGG - Intergenic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913214501 1:116609349-116609371 CGGAGGCTGAGGTGGGAGGATGG - Intronic
913556453 1:119971972-119971994 ATGAGGGAAATGAGGGAGGAAGG + Intronic
915073805 1:153293077-153293099 CAGAGGGTAAGGGGGAAGGATGG + Intergenic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915287656 1:154863081-154863103 CTGAGTGACAGGAGAGGGGAAGG - Intronic
915692124 1:157700162-157700184 CTGAGGCTTAAGAGGGAGGGTGG + Intronic
915738266 1:158098363-158098385 CTAAGGATCAGGGTGGAGGAAGG - Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
915920977 1:159974800-159974822 CTGAGGATCATGATGAAGGATGG + Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916463260 1:165048134-165048156 ATAAGGGGCAGGAGGGAGGAGGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917607364 1:176646540-176646562 GTGGGGGTCAGGTGGGGGGATGG - Intronic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918234677 1:182569356-182569378 TTGAGGGAAAGGAGGGAGGGGGG - Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919470678 1:197975645-197975667 GTAAGGTTCAGGAGGGAAGATGG - Intergenic
919770163 1:201153659-201153681 GTGCGGGTGAGGAGTGAGGAAGG - Intronic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920363566 1:205436110-205436132 CTGAGGGGCGGGAGGAAGGCAGG - Intronic
920526155 1:206668073-206668095 CTGAGTGGCAGGATGAAGGAGGG + Intronic
920647487 1:207814179-207814201 CTGGGAGTCAGGAGGCAGCATGG - Intergenic
920808474 1:209257716-209257738 CAGTTGGTCAGCAGGGAGGAAGG - Intergenic
921014534 1:211176337-211176359 CTGAGGGTCAGTGTGGGGGATGG + Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921293870 1:213683841-213683863 CCCAGGGTGAGGAGGGAGGGAGG - Intergenic
921329283 1:214019566-214019588 CTGAGGGTCGGGATGCAGGCAGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921883825 1:220283716-220283738 GTGATGGTGGGGAGGGAGGAAGG - Intergenic
921939476 1:220825152-220825174 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
922404780 1:225300594-225300616 GGGAGGGTGAGGTGGGAGGATGG + Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922524479 1:226289465-226289487 GGGAGGTTCAGGTGGGAGGATGG - Intronic
922541574 1:226424155-226424177 CAGAGGTTGAGGTGGGAGGATGG + Intergenic
922816415 1:228452725-228452747 TGGAGGGTCAGGAGGGATCAGGG - Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923023915 1:230189205-230189227 CTGAGGCTTAGGAGAGACGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923536652 1:234857769-234857791 GTCAGGGTCTGGAGGGAGTAGGG + Intergenic
923738657 1:236635568-236635590 CAGAGGGTCAGGAGCAGGGAGGG + Intergenic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
924872053 1:248058372-248058394 CTGGGGGTGATGACGGAGGAGGG - Intronic
1062779487 10:188486-188508 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1062780615 10:202652-202674 ATGAAGGTCAGGAGAGAGTATGG - Intronic
1062878066 10:957899-957921 AGGAGGCTGAGGAGGGAGGAGGG - Intergenic
1063411493 10:5840041-5840063 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064058784 10:12119668-12119690 CCGAGGGTCATGGGGGAGGAGGG + Intronic
1064585556 10:16836567-16836589 CAGAGGGGCAGGAGGAAGGGAGG + Intronic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1065223557 10:23520481-23520503 GTGAGTGGCAGGATGGAGGAGGG - Intergenic
1065439002 10:25729893-25729915 CTGGTGGTGAGGTGGGAGGATGG + Intergenic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1065780227 10:29160397-29160419 CAGAGGGGTAGGAGAGAGGAGGG + Intergenic
1065901837 10:30214912-30214934 CCCAGAGTAAGGAGGGAGGAGGG - Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1066144855 10:32547120-32547142 GGGAGGGTGAGGCGGGAGGATGG - Intronic
1066696620 10:38084702-38084724 ATGAGGGTGGGGTGGGAGGAGGG + Intergenic
1067438104 10:46292889-46292911 CTGAGGGTCAGCCGGCAGGAAGG + Intronic
1067514663 10:46927920-46927942 CTGAGGTTCAGGAGGTTGGAGGG + Intronic
1067574906 10:47403026-47403048 CTGAGGGCCAGCCGGCAGGAAGG + Intergenic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067647596 10:48123893-48123915 CTGAGGTTCAGGAGGTTGGAGGG - Intergenic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1067925589 10:50505109-50505131 GGGAGGGTGAGGTGGGAGGATGG + Intronic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1069289217 10:66756592-66756614 GTAGGGGTCAGGAGAGAGGAAGG - Intronic
1069795436 10:71048906-71048928 CTGAGGGGCAGGAGACAGGCAGG + Intergenic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1070127897 10:73636558-73636580 TGGAGGGTGAGGTGGGAGGATGG - Intronic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070630474 10:78081165-78081187 CTGGGGGGCAGGAGGAAGAATGG + Intergenic
1070769945 10:79076386-79076408 CTCAGGGTGAGGACGAAGGATGG + Intronic
1070913853 10:80140165-80140187 CTGAGGGACAGGAGGAAGACAGG - Intronic
1071156298 10:82692942-82692964 CAGAGGGTCAGGACACAGGAAGG + Intronic
1071664601 10:87542402-87542424 GGGAGGGTGAGGTGGGAGGATGG - Intronic
1071815568 10:89229314-89229336 CCAGGGGTTAGGAGGGAGGAAGG + Intronic
1071863186 10:89697280-89697302 GGGAGGGTGAGGTGGGAGGATGG - Intergenic
1071893972 10:90044040-90044062 TTGAGGGCCAGTAGGGAGGGCGG - Intergenic
1072001629 10:91200945-91200967 GGGAGGGTCAGGTGGGAGAATGG + Intronic
1072273606 10:93801266-93801288 CTGAGTGTCAGGATGGAAGATGG - Intergenic
1072545753 10:96436788-96436810 GGGAGGGTGAGGGGGGAGGATGG - Intronic
1072702733 10:97655677-97655699 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1074129727 10:110563346-110563368 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1074638294 10:115346266-115346288 CTTAGGGTCTGGAAGGAGGTGGG - Intronic
1074847178 10:117408604-117408626 CAGAGGCTTAGGAGGGAGCATGG + Intergenic
1074948467 10:118304210-118304232 CTGGAGGTCAGAAGGGAGGGAGG - Exonic
1075014515 10:118900431-118900453 AGGAGGGTGAGGTGGGAGGATGG - Intergenic
1075065750 10:119287944-119287966 CCCAGGGCCAGCAGGGAGGACGG - Intronic
1075087364 10:119422574-119422596 GGAAGGCTCAGGAGGGAGGAGGG - Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075735567 10:124662574-124662596 CGGAGGCTCAGGCAGGAGGATGG + Intronic
1075933794 10:126322599-126322621 GTGAGGGACAGGAGAGAGGCTGG + Intronic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076331702 10:129675158-129675180 CTGAGGGCCAGGCGGGAGCAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076762911 10:132614553-132614575 CTGATTCTCAGGAGAGAGGACGG - Intronic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076923772 10:133470678-133470700 CTGAGGGGCAGGACACAGGAAGG - Intergenic
1077001795 11:326996-327018 ATGAGGGTCAGGGGGGAGGGGGG + Intronic
1077027387 11:447043-447065 CTGAGGGGCAGGGGTGAGGCCGG - Intergenic
1077055090 11:587680-587702 GTCAGGGGCAGGAGAGAGGATGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077300372 11:1843954-1843976 CTGAGGGACATGAGGAAGGCAGG + Intergenic
1077328091 11:1972262-1972284 CCGAGGGACAGGAAGGAGCATGG - Intronic
1077394999 11:2316338-2316360 CTGAGGGGCAGGAGGTGGGAAGG - Intronic
1077532203 11:3102659-3102681 CTGAGGCTCAGGTGAAAGGATGG - Intronic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1077663564 11:4089753-4089775 CTGAGGGTCAGAAGTTAGGAAGG - Intronic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078390615 11:10932330-10932352 CTGAGGGTCACGATGGAAGGAGG + Intergenic
1078528359 11:12117884-12117906 CTGAGGGTCTGGAAAGAGGTTGG - Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1079158856 11:17974185-17974207 CTGAGGGACAGATGGGAGCAGGG - Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079309939 11:19356265-19356287 TATAGGGTCAGGGGGGAGGATGG + Intronic
1079802118 11:24882606-24882628 CCGAAGGTTAAGAGGGAGGAAGG - Intronic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081430891 11:42975487-42975509 CTGAGGGGCATGAGTGAAGAGGG - Intergenic
1081603694 11:44513304-44513326 GGGAGAGTGAGGAGGGAGGATGG + Intergenic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081813002 11:45923576-45923598 AGGAGGGTCAGGAGTGGGGAAGG + Intronic
1081877532 11:46419804-46419826 ATGAAGGTGGGGAGGGAGGAAGG + Intronic
1082797549 11:57388972-57388994 CTGAGGCTGAGGTGGGAGCATGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083275476 11:61594728-61594750 CTGAGAGTGAGGACGGGGGAGGG + Intergenic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083563642 11:63694575-63694597 CGGAGGCTGAGGTGGGAGGACGG - Intronic
1083704100 11:64501285-64501307 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083824078 11:65188457-65188479 CTCCGGGTCAAGATGGAGGACGG + Exonic
1084225147 11:67711058-67711080 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
1084262967 11:67990901-67990923 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
1084329048 11:68419471-68419493 GGGAGGGTGAGGTGGGAGGATGG - Intronic
1084399814 11:68936995-68937017 CAGAGGGTCAGGAGCGCGCAGGG + Exonic
1084431765 11:69115314-69115336 CTGTGGGTCAGGGGGATGGAGGG + Intergenic
1084480087 11:69415072-69415094 CTGAGGGGCAGAGGAGAGGATGG + Intergenic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084724767 11:70934366-70934388 CTGAGAAGCAGGAGGGAGGCCGG - Intronic
1084793983 11:71491975-71491997 CCTGGGGTCAGGAGGGAGGTAGG - Intronic
1084810426 11:71608215-71608237 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1085692718 11:78676971-78676993 CTGAGGGGCAGGAGGGAACGTGG + Intronic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1086993485 11:93330797-93330819 GTGAGGGTCAGGGGCGAGGCGGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087585184 11:100110080-100110102 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088444423 11:109909410-109909432 GAGAGGGTGAGGTGGGAGGATGG - Intergenic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089391186 11:118103045-118103067 CTGAGGGTCAGGCTTGAGCAGGG - Intronic
1089530279 11:119123645-119123667 GGGAGGTTCAGGTGGGAGGAAGG - Intronic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089775921 11:120835714-120835736 CCGACTGTCAGGAGGGATGAGGG + Intronic
1090076666 11:123584206-123584228 CGGAGGGTGGGCAGGGAGGAGGG - Intronic
1090093722 11:123723689-123723711 CTGAGCGTGAGCAGGGAGGTTGG - Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090399693 11:126441143-126441165 CTGAGACACAGGTGGGAGGAGGG - Intronic
1090471582 11:126985598-126985620 CAGAGGGACAGGAGGCACGAGGG + Intronic
1090674301 11:128974860-128974882 ATGAGAGTGAGGAGGAAGGAGGG - Exonic
1090799018 11:130159476-130159498 CGGAGGCGCATGAGGGAGGAGGG + Intergenic
1090799906 11:130163938-130163960 GTGAGGGTCAGGTAGGGGGAGGG - Intronic
1090966401 11:131601105-131601127 GTAAGGGCCAGGAGGCAGGATGG + Intronic
1090977840 11:131691487-131691509 CGGGGGGCCAGGAGGGAGCAAGG - Intronic
1091305344 11:134532685-134532707 CTGAGGGGCAGGACGGGAGATGG + Intergenic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1202811070 11_KI270721v1_random:27442-27464 CCGAGGGACAGGAAGGAGCATGG - Intergenic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091552463 12:1546871-1546893 CTCAGGTTCAGGATGTAGGAGGG + Intronic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1091747167 12:2999802-2999824 CTGAGTGTGAGGAGCGGGGAAGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1092278001 12:7076802-7076824 CTGAGGATCAGGGAGGAGAAAGG - Intergenic
1092451121 12:8603217-8603239 GGGAGGTTGAGGAGGGAGGATGG - Exonic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092802742 12:12186833-12186855 GTGAGGATCAGGAGGAGGGAGGG - Intronic
1093276313 12:17132495-17132517 CTGTGGGCCATGACGGAGGAGGG + Intergenic
1093558679 12:20510821-20510843 CTGAGAGTGAAGAGGAAGGAAGG + Intronic
1093850712 12:24034346-24034368 CTGAGAGGCAGGAGAGAGGAGGG - Intergenic
1094435625 12:30417968-30417990 CTGAGGGTGAGGAGTCAGGTGGG + Intergenic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096276378 12:50211731-50211753 CTGAGGTACAGGAAGAAGGAGGG + Intronic
1096314414 12:50551546-50551568 GTGAGGGTGAGGTTGGAGGATGG - Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096536123 12:52275936-52275958 CTGAGAGTCAGGTGAGAGGTGGG + Exonic
1096575982 12:52553097-52553119 CTCAGATGCAGGAGGGAGGAAGG + Exonic
1096618651 12:52848744-52848766 CTGGGGGTCAGGGGGTAGGCTGG - Exonic
1096624959 12:52889084-52889106 CTCAGGCACAGGATGGAGGAGGG - Intergenic
1096724324 12:53548878-53548900 GGGAGGGTGAGGTGGGAGGATGG + Intronic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097214981 12:57403705-57403727 GTGAGGCTGAGGTGGGAGGAGGG + Intronic
1097675051 12:62591285-62591307 CTGAGGGTGAGGAGTCAGGCTGG - Intronic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098572231 12:72001280-72001302 CTAAGGGTAATGAGGGAGTAAGG + Intronic
1098610805 12:72455071-72455093 AAGAAGGTCAGGAAGGAGGAAGG + Intronic
1098622525 12:72620416-72620438 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1098716119 12:73830074-73830096 CTGAGGGAGAGAAGGGAGGGTGG - Intergenic
1100377277 12:94029113-94029135 CAGAGGGTCAGAAGAGGGGAAGG - Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100581051 12:95940903-95940925 CTGGAGGTCAAGAGGAAGGAAGG + Intronic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1101207276 12:102501197-102501219 CGGAGGCTGAGGCGGGAGGATGG + Intergenic
1101382594 12:104227504-104227526 GGGAGGCCCAGGAGGGAGGATGG - Intronic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102150762 12:110688090-110688112 CAGAGGGGCAGGACGGAGGGTGG + Exonic
1102190036 12:110980842-110980864 TAGAGAGACAGGAGGGAGGACGG + Intergenic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102255993 12:111415323-111415345 GCGAGGGTCAGGAGGAAGGAAGG + Intronic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102431531 12:112887939-112887961 CTGAGGATCTGATGGGAGGAGGG + Intronic
1102531571 12:113550455-113550477 CTGATGGTAAGGTGGAAGGATGG - Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1102752416 12:115307067-115307089 TGGAGGCTCAGGTGGGAGGAAGG - Intergenic
1103023465 12:117555096-117555118 GTGAGGGGTAGGAGGGAGGAAGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103290315 12:119840211-119840233 AGGAGGGTGAGGTGGGAGGACGG + Intronic
1103454042 12:121050766-121050788 TTTAGAGTCAGGAAGGAGGATGG - Intergenic
1103497961 12:121377499-121377521 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1103723508 12:122986860-122986882 GGGAGGCCCAGGAGGGAGGAAGG - Intronic
1103967301 12:124647978-124648000 GTGAGGGTCCGGTGGGAGGCAGG - Intergenic
1104318536 12:127727239-127727261 TTGAGGGTTAGGAAGGAGCAGGG - Intergenic
1104487106 12:129161159-129161181 CTGAGGAACAGCAGGAAGGAGGG + Intronic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1104658446 12:130591633-130591655 ATGAGGGTCAGGGCGGAGGCTGG - Intronic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104772727 12:131373881-131373903 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104976810 12:132555828-132555850 CTGAGGGTCAGGATGGGTGTGGG + Intronic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1105218230 13:18302821-18302843 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105405127 13:20127371-20127393 GTGAGGGTGAGGAGGGTGGGGGG - Intergenic
1105472659 13:20706159-20706181 CTGAAGGACAGGAGTGAGAAGGG - Intronic
1105772668 13:23627629-23627651 GCGAAGGGCAGGAGGGAGGACGG + Intronic
1105859231 13:24394854-24394876 CTGAGAGACAGGGAGGAGGAGGG - Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1107014487 13:35697252-35697274 AACAGGGTCAGGAGAGAGGAAGG - Intergenic
1107940457 13:45377490-45377512 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107940595 13:45377886-45377908 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941070 13:45380116-45380138 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941184 13:45380429-45380451 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941572 13:45381812-45381834 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941714 13:45382208-45382230 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1108053045 13:46464221-46464243 CTGAGAGCCAGGGGGGAAGAGGG - Intergenic
1108167800 13:47711006-47711028 CTGGGGGTTAGGAGGGATGGAGG - Intergenic
1108688222 13:52839168-52839190 TTGAGGCTGAGGAGGGAGGCAGG + Intergenic
1110342600 13:74410583-74410605 GTGAGGGTCATGGGGGTGGAGGG - Intergenic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1110702161 13:78561671-78561693 CCAAGGGTTAGGAGGGAGAAAGG + Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111600303 13:90464795-90464817 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1111931601 13:94518305-94518327 CTGAGGGTAAGCAGTGTGGAGGG - Intergenic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1112928803 13:104710726-104710748 ATGTGGGGCAGGTGGGAGGAGGG + Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113425744 13:110207098-110207120 CTGGGGGGCAGGAGGGGGGCAGG - Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1113790197 13:113024292-113024314 CTCAGTGTCAGGAAGGAGGCAGG + Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1114276364 14:21149081-21149103 CTGTGGGTCAGGAGGCTGCAAGG + Intergenic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114489515 14:23090028-23090050 CTGAAAGTCAGGAGGCAGCAGGG + Exonic
1114646404 14:24258885-24258907 CTAAGGGAAAGGAGGGAGAAGGG - Intronic
1115167463 14:30464877-30464899 AGGAGGGGCAGGAGGCAGGAGGG + Intergenic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115433567 14:33348311-33348333 ATGAGGGTGAGGAGGCAGGGAGG + Intronic
1117061107 14:51964769-51964791 CGGAAGGTGAGGCGGGAGGATGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117222945 14:53624694-53624716 CTGAGGGTTCGGAGTAAGGAGGG + Intergenic
1117654178 14:57937533-57937555 ATGATGGTCAGAAGGAAGGAAGG + Intronic
1117711886 14:58538882-58538904 GGGAGGCTCAGGTGGGAGGATGG - Intronic
1117804284 14:59474342-59474364 CTTAGAGTCAGGAGGCAGGATGG + Intronic
1117991210 14:61435599-61435621 TGGAGGCTCAGGTGGGAGGATGG + Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1118992813 14:70810824-70810846 GGGAGGGTGAGGTGGGAGGATGG - Intergenic
1119071013 14:71584220-71584242 GAGAGGTTCAGGATGGAGGATGG + Intronic
1119178904 14:72590867-72590889 CTGAGGATCAGGACTGGGGAAGG + Intergenic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119620896 14:76131234-76131256 GTGACGGTCAGGCCGGAGGAAGG + Intergenic
1119887151 14:78152654-78152676 CTGAGAGGCAGGAAGAAGGAGGG - Intergenic
1120165817 14:81198338-81198360 GGGAGGGTGAGGTGGGAGGATGG + Intronic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1121009084 14:90509445-90509467 CTGGGGTCCAGGAGGGAGAAAGG - Intergenic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121190695 14:92026759-92026781 GTGAGGGTGAGGAAGAAGGATGG + Intronic
1121322392 14:92999576-92999598 CTGAGGCCCAGCAAGGAGGAGGG - Intronic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122293921 14:100694400-100694422 CTGAGAGTCGGGTGGGGGGAAGG - Intergenic
1122307444 14:100774701-100774723 GTGAGGCTGAGGCGGGAGGATGG - Intergenic
1122416070 14:101550094-101550116 CTGAGGGTCCGGGAGGAGGTGGG - Intergenic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122969611 14:105147190-105147212 CTGAGGCTCAGAAGAGAGGCAGG + Intronic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123007039 14:105328842-105328864 CTAAGGGTCACGAGGCAGGGCGG + Intronic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124776383 15:32593531-32593553 CGCAGGGTGGGGAGGGAGGAAGG - Exonic
1124866710 15:33499305-33499327 AAGAGTGGCAGGAGGGAGGAGGG - Intronic
1125411614 15:39411925-39411947 CTGATGGTAAGGTAGGAGGAAGG + Intergenic
1125490790 15:40147115-40147137 TGGAGGGTCAGGGGTGAGGAAGG + Intergenic
1125594446 15:40875304-40875326 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1125733181 15:41905772-41905794 GAGAGGGTGAGGTGGGAGGATGG - Intronic
1125739541 15:41952489-41952511 AGGAGGTGCAGGAGGGAGGAAGG + Intronic
1126751053 15:51876956-51876978 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1127260798 15:57324592-57324614 GGGAGGGACAGGAGGGAGGGAGG - Intergenic
1127456399 15:59159476-59159498 TGGAGTGTCAGGAGGGAGGTGGG + Intronic
1127456513 15:59160512-59160534 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1127854746 15:62945220-62945242 CTGAAGGGCAGGAGGCTGGAAGG + Intergenic
1128096332 15:64959178-64959200 CTGAGGGGCAGGAGGGGGAGGGG + Intergenic
1128542178 15:68543807-68543829 GTGTGCGTCAGGAGGGTGGAGGG - Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128637793 15:69314301-69314323 AGGAGGGACAGGAGGGAGAAGGG - Intronic
1128730234 15:70015811-70015833 CTGGGGGTCAGGAGGGCTGCGGG - Intergenic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129102177 15:73275548-73275570 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1129571766 15:76693814-76693836 ACCAGGGTCTGGAGGGAGGAGGG + Intronic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1129959004 15:79666266-79666288 ATGAGGGTGAGGTGGGAGGTTGG + Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130250076 15:82294338-82294360 CTGAGAGTCAGGAGGTTGGATGG - Intergenic
1130552280 15:84897779-84897801 CTGAAGGGGAGGAGGGAGGCGGG - Intronic
1130721277 15:86387737-86387759 CTTGGGGACAGCAGGGAGGAAGG - Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130916484 15:88309156-88309178 GGGAGGGTGAGGCGGGAGGATGG - Intergenic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131468058 15:92671389-92671411 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1131627278 15:94134753-94134775 CGGAGGGTCAGGAGAGTGAATGG - Intergenic
1132140092 15:99385163-99385185 CTGAAGGGCAGGAAGAAGGAAGG - Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132641756 16:981423-981445 CTGAGCGTCAGGACGGGGGGCGG + Intergenic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132709170 16:1258870-1258892 AGGAGGCTCAGGATGGAGGAGGG - Exonic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133742170 16:8659963-8659985 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1133742935 16:8664968-8664990 CTGAGGGTCCCTGGGGAGGAGGG + Intergenic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1134048455 16:11119493-11119515 AGGAGGCTCAGGTGGGAGGATGG - Intronic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134260582 16:12647967-12647989 CTGAGGGCCAGGAGGGCTGGAGG - Intergenic
1134333555 16:13272465-13272487 CTGAGGTCGAGGTGGGAGGATGG - Intergenic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135667563 16:24348956-24348978 CTAGGGGTGAGGAGAGAGGAAGG - Intronic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136092149 16:27928242-27928264 CTGAGGCTCAGGAGGTTGAAAGG + Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136471108 16:30480890-30480912 CGGAGGCTGACGAGGGAGGATGG + Intronic
1136495534 16:30641239-30641261 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1137249926 16:46733787-46733809 CTGAGTCTCAGCAGGGAGGCAGG + Intronic
1137469044 16:48738192-48738214 CTGAGGTACAGCAGGGAGAAGGG - Intergenic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1137738955 16:50746140-50746162 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138220555 16:55246664-55246686 ATAAGTGTGAGGAGGGAGGATGG - Intergenic
1138301400 16:55932769-55932791 ATGAGGTTCAAGAGGGAGGCAGG + Intronic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138565113 16:57827508-57827530 CTGAGGGACAGGCAGGAGAAGGG - Intronic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139582552 16:67881978-67882000 CTGAGGGGCAGCAGCGGGGAGGG + Exonic
1139701223 16:68709309-68709331 GGGAGGCCCAGGAGGGAGGATGG - Intronic
1140145810 16:72307321-72307343 CTATGAGTCAGGAGGGAGGAAGG + Intergenic
1140223947 16:73064172-73064194 CTGGGGGGCAGGAGGCAGGTGGG + Intergenic
1140237481 16:73172304-73172326 CTGGCGGGCAGGAGGAAGGAGGG - Intergenic
1140344562 16:74200291-74200313 CTTGGGGTCAGGAAGGGGGAAGG + Intergenic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1140963913 16:79945182-79945204 CTGAGAGGCATAAGGGAGGAGGG + Intergenic
1141135725 16:81463952-81463974 CTGAGGGGCAGGAGAAATGAAGG - Intronic
1141431088 16:83970443-83970465 CTGAGGTTCAGCCAGGAGGAGGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141690067 16:85591592-85591614 CTCAGGGTCAGAGGGGAGGCTGG - Intergenic
1141750928 16:85957374-85957396 CTGAGGCTCAGAGGGGTGGAGGG + Intergenic
1141756238 16:85992961-85992983 CAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141882337 16:86868269-86868291 GTGAGGGTGAGGTGGGCGGAGGG + Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1141977654 16:87528173-87528195 GTCAGGGGCCGGAGGGAGGAGGG - Intergenic
1142166121 16:88589629-88589651 CTGAGTGACAGAAGGGAGCACGG + Intronic
1142289715 16:89187988-89188010 CTGGGAGGCAGGAGGGAGGGTGG + Intronic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1142534551 17:605445-605467 CTGAGGGACAGAAAGGAAGATGG + Intronic
1142620815 17:1164769-1164791 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1142632242 17:1232551-1232573 CGCAGGCTGAGGAGGGAGGATGG - Intergenic
1143104142 17:4520008-4520030 TCCAGGGTCAGGAGGGAGGTGGG - Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1144198817 17:12920646-12920668 GTGAGAGCCAGGAGGTAGGATGG + Intronic
1144649456 17:16998107-16998129 CTGAGAGTCAGAGGGGAGGCTGG - Intergenic
1144658069 17:17050769-17050791 TTTAGGGGCAGAAGGGAGGAAGG + Intronic
1144723986 17:17492198-17492220 CTGAGGGTGATGAACGAGGAAGG - Exonic
1144754745 17:17672347-17672369 CGGGGGATCAGGAGGGTGGAGGG + Intergenic
1144835035 17:18152187-18152209 GAGAGGGCCAGGAGGGAGGGAGG + Intronic
1144955763 17:19018108-19018130 CTGAGGGAGAGGGTGGAGGAAGG - Intronic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145277353 17:21440536-21440558 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145315191 17:21726431-21726453 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145713622 17:26998367-26998389 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145880676 17:28350700-28350722 CTGGGGGTCAGGGTGGAGGTGGG - Intronic
1146003108 17:29143335-29143357 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146112510 17:30102941-30102963 GGGAGGCTCAGGTGGGAGGAGGG - Intronic
1146202105 17:30867714-30867736 GGGAGGCTCAGGTGGGAGGATGG - Intronic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146683908 17:34827630-34827652 CGGAGGGTCTGGAGGAAGGGGGG - Intergenic
1146798237 17:35798062-35798084 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1146858551 17:36276041-36276063 GGGAGGGTGAGGTGGGAGGATGG - Intronic
1146891831 17:36511342-36511364 GTGAGGGTCAGGGTGTAGGATGG - Intronic
1146916036 17:36679098-36679120 CTGAAGGTCACGTGGGAAGACGG + Intergenic
1147088872 17:38080117-38080139 GGGAGGGTGAGGTGGGAGGATGG - Intergenic
1147108336 17:38240408-38240430 GGGAGGGTGAGGTGGGAGGATGG + Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147256723 17:39186111-39186133 CGGAGAGTCAGGAGAGAGGGAGG + Intronic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1147865211 17:43547274-43547296 CTGATGATCTGGAGGCAGGATGG + Intronic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148338526 17:46858639-46858661 CTGAGGATCAGGTGAGAGAAGGG - Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148421061 17:47547448-47547470 GGGAGGGTGAGGTGGGAGGATGG - Intronic
1148491323 17:48025588-48025610 CGGAGGGACAGGAGGGTGAAAGG - Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149553279 17:57555589-57555611 AGGGGGTTCAGGAGGGAGGAAGG - Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149694863 17:58608860-58608882 CAAATGGTCAGGAGGGAGCAGGG + Intronic
1149758035 17:59204289-59204311 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1150293064 17:63992976-63992998 GGCAGAGTCAGGAGGGAGGAAGG + Intergenic
1150385383 17:64755288-64755310 GGGAGGCTCAGGAGGGAGGATGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150635626 17:66911346-66911368 CTCAGTGACAGGAGGGATGATGG - Intergenic
1150770951 17:68040332-68040354 GGGAGGCTCAGGAGGGAGGATGG - Intronic
1150843975 17:68636300-68636322 TTGAGGGTCAGGGGGCAGGGTGG - Intergenic
1151443049 17:74145971-74145993 GACAGGGACAGGAGGGAGGAAGG - Intergenic
1151762828 17:76116289-76116311 GGGAGGGTGAGGTGGGAGGATGG - Intronic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1151891988 17:76956464-76956486 CTGAAGGGCAGCAGAGAGGACGG + Intergenic
1151966957 17:77436552-77436574 CTGAGGGTCTGCGTGGAGGAGGG - Intronic
1152182013 17:78828427-78828449 CTGAGGGAGAGCTGGGAGGAGGG - Intronic
1152217237 17:79040797-79040819 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG + Intronic
1152225363 17:79090302-79090324 CTGCCGGGCAGGAGGGAGGTGGG + Intronic
1152230045 17:79109846-79109868 CCGAGGATGAGGCGGGAGGAAGG + Intronic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152541630 17:80979643-80979665 CTGAAGGTCAGGAAGGATGCTGG - Intergenic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152580305 17:81162811-81162833 CTGAGGGACAGGGGAGAGGCGGG + Intronic
1152610819 17:81314332-81314354 GTTATGGTCTGGAGGGAGGAGGG - Intronic
1152622533 17:81372479-81372501 TGGAGCTTCAGGAGGGAGGAGGG - Intergenic
1152707735 17:81853748-81853770 GTGAGGGGCAGGAGGGCGGCCGG - Intronic
1152745055 17:82034690-82034712 CAGAGGGGCAGGGTGGAGGAGGG + Intergenic
1152906734 17:82974522-82974544 GTGAGGGACAGGAGTGAGGCAGG + Intronic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153756873 18:8293064-8293086 GTGAGGATCAGGTGAGAGGATGG + Intronic
1154261560 18:12838550-12838572 CTGGGAGGCAGTAGGGAGGAGGG + Intronic
1154388104 18:13913692-13913714 CTGAGTGTGAGAAGTGAGGAAGG - Intronic
1155359105 18:24982403-24982425 GTGAGGGTCAGGGAGCAGGAAGG - Intergenic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1155970261 18:32076418-32076440 GGGAGGGTGAGGTGGGAGGATGG - Intergenic
1156023830 18:32629710-32629732 CAGACGGACAGGAGGGAGCAAGG + Intergenic
1156108271 18:33691969-33691991 CTGAGGGTCAGGGAGGAAAAAGG + Intronic
1156161555 18:34365153-34365175 GTCAGAATCAGGAGGGAGGAGGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156521261 18:37724063-37724085 CTGAGGGGCAGGTTGGAGGGGGG + Intergenic
1157204929 18:45689684-45689706 GTGATGGTAAGGAGGGAGGGTGG - Intergenic
1157439207 18:47697177-47697199 GTGAGGGTCAAGAGGAAGGGTGG - Intergenic
1157520647 18:48342805-48342827 GGGAGGGCCAGGAGGGAGGGAGG + Intronic
1157547943 18:48560673-48560695 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1157786858 18:50491435-50491457 ATGAGGGTTAGGAGGGTGGTTGG + Intergenic
1158977765 18:62727746-62727768 TTGAGGGACAGTAGGGAGAAAGG + Intronic
1159038847 18:63303770-63303792 CCGAAAGTCAGGAGGAAGGAAGG - Intronic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160348322 18:78152959-78152981 ATGAGGGCCAGCAGGGAGCAGGG + Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160818347 19:1046568-1046590 CTGAGGGTCTGGTGGGGGGGGGG + Intronic
1160917879 19:1506397-1506419 CTGAGGGTCAGGTGGGACCTCGG + Intronic
1160953190 19:1677285-1677307 CTGAGGATCTGGGGGGTGGAGGG + Intergenic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1161323950 19:3654104-3654126 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1161413275 19:4129309-4129331 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161533465 19:4804198-4804220 CTGAGGGGTAGGAGGGAGCGTGG - Intergenic
1161551725 19:4916706-4916728 CGGAGGGAGAGAAGGGAGGAAGG - Intronic
1161709966 19:5842140-5842162 CTGAGGCCCAGGTGGGAGGGTGG - Intergenic
1161833897 19:6631717-6631739 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162202104 19:9028029-9028051 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162392499 19:10397997-10398019 CTGAGGTTCAGGAGAGGTGATGG - Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162535980 19:11262845-11262867 CTGAGCCTGAGGAGGGAGGGAGG + Intergenic
1162536020 19:11262960-11262982 CTGAAGCTCAGGAGGGAGGGAGG + Intergenic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162950138 19:14066616-14066638 TGGAGGCTCAGGCGGGAGGATGG - Intergenic
1163069913 19:14830870-14830892 CTGAGGGTCAGGTGATAAGACGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163270783 19:16252302-16252324 ATGAGGGTCAGGAGTGGGGCTGG - Intergenic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163779650 19:19239708-19239730 GGGAGGAGCAGGAGGGAGGAGGG - Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1163808816 19:19417533-19417555 CTGAGGTCCAGGAGGGTGAATGG - Intronic
1164521188 19:28981622-28981644 CTAACAGCCAGGAGGGAGGAAGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164882310 19:31742660-31742682 ATGAAGGACAGGAGGGAGGGAGG + Intergenic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165432043 19:35778432-35778454 CAGAGGGACAGAAGGGAGCAGGG - Intronic
1165767226 19:38359194-38359216 CTGAGGGTCGAGAGGGTGGCTGG - Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1165988945 19:39794951-39794973 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1166145153 19:40829182-40829204 TTGAGGGTAAGATGGGAGGAGGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166176375 19:41074476-41074498 CTCAGGGGCGGGAGGGGGGATGG - Intergenic
1166215427 19:41331505-41331527 CGGAGGCTGAGGCGGGAGGATGG - Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166398661 19:42461707-42461729 ATTAGGGTGGGGAGGGAGGAGGG - Intergenic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166529100 19:43532131-43532153 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1167158685 19:47754504-47754526 CTGAGGGGCGGGAGTGAGGATGG - Intronic
1167240186 19:48338883-48338905 CTGAGGGTGAGGGGTGAGCAGGG + Intronic
1167284036 19:48588853-48588875 CTGAGGTGCAAGAGGGAGGTCGG + Intronic
1167295332 19:48646191-48646213 GGGAGGGGGAGGAGGGAGGAAGG - Exonic
1167497895 19:49830137-49830159 CTGAGGGTGCGGCGGGAGGCAGG - Exonic
1167507489 19:49878476-49878498 CCTAGGGTAAGGAGGGAGGCGGG - Exonic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1167951662 19:53032509-53032531 CTGAGGGAGAGAAGGCAGGATGG - Intergenic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168251592 19:55145369-55145391 AGGAGGGAGAGGAGGGAGGAGGG + Intronic
1168287987 19:55343844-55343866 GTGAGGGTCAGGCAGGTGGATGG + Intronic
1168333618 19:55584494-55584516 AGGAGGCTCAGGTGGGAGGATGG - Intergenic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1202703511 1_KI270713v1_random:4781-4803 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
924973288 2:150947-150969 CTGAGGGACAGGAGTGGGGCTGG + Intergenic
925067314 2:938437-938459 CTCAGAGTCCGGAGGGAGGCAGG - Intergenic
925075271 2:1011210-1011232 CTGAGGGCCAGGTGGGAGCAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
926143409 2:10382268-10382290 CTACGGGTTAGGAGGGAGGGAGG + Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926722486 2:15971494-15971516 ACGAGGGTCAGGAGGGAAGAAGG + Intergenic
926744702 2:16141408-16141430 CTGAGGCTCAGGGAGGTGGAGGG - Intergenic
926999080 2:18773457-18773479 GTGAGGGTCATGAGGAAGGAAGG - Intergenic
927089952 2:19702884-19702906 ATGAGGGCCAGCAGGGAGGGGGG + Intergenic
927149029 2:20185294-20185316 CTGAGGGTCAGACTGGAGGGCGG + Intergenic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
927830979 2:26349866-26349888 CGGAGGCTGAGGTGGGAGGATGG + Intronic
927885473 2:26715677-26715699 CTGAGGGCCGGGAGGGTGTAGGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928199953 2:29241469-29241491 CTTAGGGCCAGGAGGGAGATGGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929230641 2:39556496-39556518 AAGAGGGTGAGGTGGGAGGATGG - Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
929687495 2:44047227-44047249 CTGAGAGTGAAGGGGGAGGATGG + Intergenic
929695433 2:44110896-44110918 CTGAGGGTCAGAAGTCTGGAGGG - Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929881065 2:45837767-45837789 GTGAGGCTGAGGTGGGAGGAAGG + Intronic
930763282 2:55059456-55059478 CGGAGGCTGAGGTGGGAGGATGG - Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
931686495 2:64798478-64798500 TTGAGGGGCAGGATGGGGGATGG - Intergenic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932192082 2:69749336-69749358 TTGAGAGACAGGAGGTAGGAGGG + Intronic
932238516 2:70140003-70140025 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
934523534 2:95034615-95034637 CTGGGGGCCAGGATGGAGGCTGG - Intronic
934524578 2:95043748-95043770 CTGGGGGACAGGGCGGAGGAGGG - Intronic
934650032 2:96085419-96085441 CTGAGGGGCAGGGGTGGGGATGG + Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935193858 2:100799507-100799529 CTGAGAGTCAGAAGGGAGCCTGG - Intergenic
935194913 2:100807511-100807533 CAGAGGCTCAGGAGGGAGAGAGG + Intergenic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935985412 2:108667732-108667754 CTGAGGGTGAGGTGGGAGTGGGG - Intronic
936105105 2:109615972-109615994 CTGGAGGGCAGGGGGGAGGAGGG + Exonic
936137841 2:109911381-109911403 CTGAGGGTGAGGTGGGAGTGGGG - Intergenic
936206856 2:110460104-110460126 CTGAGGGTGAGGTGGGAGTGGGG + Intronic
936286037 2:111182142-111182164 AGGAGGCTCAAGAGGGAGGAGGG - Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936772933 2:115936837-115936859 ATGAGAGTTAGGAGAGAGGATGG + Intergenic
937104533 2:119297609-119297631 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938320557 2:130359578-130359600 AGGAGGGTCAGGGGAGAGGAAGG - Intronic
938337310 2:130511363-130511385 CTGAGGAGCAGCAGGGAGGGAGG - Intergenic
938352528 2:130609372-130609394 CTGAGGAGCAGCAGGGAGGGAGG + Intergenic
938548942 2:132361711-132361733 CTCAGGCGCAGGAGGGAGGACGG - Intergenic
938670312 2:133580225-133580247 CAGAGAGTCAGGAGGTAGAATGG - Intergenic
938826819 2:135013857-135013879 CAGAGGATCAAGAGAGAGGAGGG - Intronic
938838976 2:135139434-135139456 GGGAGGCTCAGGTGGGAGGATGG + Intronic
940138490 2:150465839-150465861 CAGAGGGTCAGGCAGAAGGATGG - Intergenic
940202082 2:151163167-151163189 CTGAGAGACAGGAGTGAGGCAGG - Intergenic
940852215 2:158699176-158699198 AGGAGGGGGAGGAGGGAGGAGGG + Intergenic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
941088003 2:161141470-161141492 TTGAGGGGCAAGAGGAAGGAGGG - Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
941799153 2:169635984-169636006 GTGAGGGTCAGGAGGTAGTAAGG - Intronic
941819877 2:169833686-169833708 CTGAGGGGTAGGATGGAGAAAGG - Intronic
941915985 2:170814256-170814278 GTTACTGTCAGGAGGGAGGAGGG + Intronic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
942883352 2:180891509-180891531 TGGAGAGTCAGAAGGGAGGAAGG - Intergenic
943756377 2:191561233-191561255 CGGAGGGTGAGGTGGGAGGATGG + Intergenic
943813854 2:192225938-192225960 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
945452830 2:210013549-210013571 AGGAGGCTGAGGAGGGAGGATGG - Intronic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
945768443 2:214009600-214009622 ATGAGGGTCGTGAGGGAGGCAGG + Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946305824 2:218856538-218856560 TTGAGGTTGAGGAGGAAGGAGGG - Intergenic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946524646 2:220505246-220505268 AGGAGTGTAAGGAGGGAGGAAGG + Intergenic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946912833 2:224484064-224484086 ATGAGGCTAAGGTGGGAGGATGG + Intronic
947220670 2:227788819-227788841 TTGAGGGTGAGGAGGGAGTTGGG + Intergenic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948146917 2:235715148-235715170 AGGAGAGACAGGAGGGAGGAAGG - Intronic
948206000 2:236163289-236163311 CCGAGGAGCAGGAGGGAGGGCGG + Intergenic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
948674479 2:239588940-239588962 CTGAGACTCAGGTGGGAGGAGGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169011824 20:2257427-2257449 CTAAGGGTCAGGAATCAGGAAGG - Intergenic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169207640 20:3749209-3749231 CTGGGGGTCAGGAGACAGCAGGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169310619 20:4535616-4535638 ATGAGTTTCAGGAGGTAGGAGGG + Intergenic
1169410969 20:5370090-5370112 ATGAGGGGCAGGAGGCAGGAGGG - Intergenic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1170465808 20:16621581-16621603 GGGAGGGTGAGGTGGGAGGATGG + Intergenic
1170934852 20:20800711-20800733 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1170937092 20:20819835-20819857 GGGAGGGTGAGGTGGGAGGATGG + Intergenic
1170978971 20:21193048-21193070 TTGAGAGACAGGAGGGAGGTGGG + Intronic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171126057 20:22603072-22603094 CAGAAGGTCTGGAGTGAGGAGGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1171877767 20:30594272-30594294 CTCAGGCGCTGGAGGGAGGACGG - Intergenic
1172038260 20:32025692-32025714 TTGAGGATCAGGAGAGGGGAGGG + Intronic
1172221263 20:33276644-33276666 CTGAAGCTCAGGAGGGAGCTGGG - Intronic
1172321250 20:33996789-33996811 TTCAGGGGCTGGAGGGAGGAGGG - Intronic
1172783814 20:37452637-37452659 CTGAGTGTCAGCACAGAGGAAGG + Intergenic
1172876973 20:38170317-38170339 CTGAGAGCCAGGTGGGTGGAGGG - Intergenic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173595403 20:44255857-44255879 CTGAGACTCAGAAGGAAGGATGG - Intronic
1173656778 20:44704910-44704932 CTCAGGGGTAGAAGGGAGGAAGG + Intergenic
1173874649 20:46362733-46362755 CGAAGGGGCAGCAGGGAGGAGGG - Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174404581 20:50294965-50294987 ATGGGGGGCAGGAGGGCGGAGGG + Intergenic
1174486864 20:50866642-50866664 CTGAGGGTCCTGAGGTTGGAGGG + Intronic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1174697534 20:52575213-52575235 CTGAGCATCTGGTGGGAGGAAGG + Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175312233 20:58019905-58019927 CTGAGGCTCAGAGGGGTGGAAGG - Intergenic
1175384355 20:58584738-58584760 AGGAGGGACAGGAGGGAGGGAGG - Intergenic
1175470526 20:59223922-59223944 CCACGGGACAGGAGGGAGGAAGG + Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175708747 20:61202354-61202376 CGGAGGGTCCTGAGTGAGGATGG - Intergenic
1175905973 20:62379641-62379663 CTGAGGCTCAGGGAGGAGAAGGG + Intergenic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176166514 20:63677002-63677024 GTGAGATTCAGGAGGGAGCATGG - Intronic
1176303853 21:5113414-5113436 GGGAGTGTCAGGAGAGAGGATGG - Intergenic
1176314130 21:5225878-5225900 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1176376544 21:6089522-6089544 CTGAGGGTGAGACTGGAGGAGGG + Intergenic
1176411159 21:6450298-6450320 CTGAGGGCCTGGAGTGAGCACGG + Intergenic
1176641704 21:9310611-9310633 CGGAGGGTGAGGTAGGAGGATGG + Intergenic
1176994114 21:15534219-15534241 ATCAGGGTCAGGTGAGAGGATGG + Intergenic
1177605486 21:23372033-23372055 CTGAGAGTCAGGAGAGCTGATGG - Intergenic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178485988 21:33020396-33020418 CTGATGGCTAGCAGGGAGGAGGG + Intergenic
1178593618 21:33932971-33932993 GAGAGGCTCAGGTGGGAGGATGG - Intergenic
1179090745 21:38263280-38263302 CTGCTGGTCAGAAGGCAGGAGGG + Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179141925 21:38733339-38733361 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179298129 21:40081499-40081521 CAAAGGCTCAGGAAGGAGGAGGG - Intronic
1179556675 21:42182987-42183009 TGGAGGGTCAGGAGTGAGGTGGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179686652 21:43058620-43058642 CTGAGGGCCTGGAGTGAGCACGG + Intronic
1179746931 21:43448722-43448744 CTGAGGGTGAGACTGGAGGAGGG - Intergenic
1179788727 21:43743557-43743579 CTCAGGGGCAGGGGGGAGGGAGG - Intronic
1179853177 21:44148536-44148558 GGGAGTGTCAGGAGAGAGGATGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180133833 21:45847385-45847407 GTGAGGGTAAGGATGGAGGTGGG - Intronic
1180236067 21:46459623-46459645 CTGAGGGTCGGGAGTCCGGAGGG - Intronic
1180350720 22:11799967-11799989 CGGAGGGTGAGGTAGGAGGATGG + Intergenic
1180387490 22:12192115-12192137 CAGAGGGTGAGGTAGGAGGATGG - Intergenic
1180391942 22:12291997-12292019 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1180407802 22:12572759-12572781 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
1180572039 22:16734219-16734241 CTGAGGGTCAGGAGTATAGATGG + Intergenic
1181062453 22:20288168-20288190 CAGAGGGGCAGGAGCGAGGAGGG - Intergenic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181824376 22:25502598-25502620 CAGAGGCTCAGGTGGGAGGATGG - Intergenic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1182016843 22:27047558-27047580 CTGAGGCTCAGGGAGGATGAGGG - Intergenic
1182025121 22:27111813-27111835 AGGAGGCTCAGGCGGGAGGATGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182243178 22:28933784-28933806 GGGAGGGGGAGGAGGGAGGAGGG - Intronic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182420954 22:30248338-30248360 GTGAGAGGCAGGAAGGAGGAAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182643486 22:31788376-31788398 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1182700146 22:32230215-32230237 CTGACACACAGGAGGGAGGAAGG - Intronic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1183017550 22:35001647-35001669 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1183109365 22:35637714-35637736 CTTAGGGTGGGGTGGGAGGATGG - Intronic
1183173534 22:36205240-36205262 AGGAGGCTCAGGTGGGAGGATGG - Intergenic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183329633 22:37212376-37212398 GAGAGAGGCAGGAGGGAGGAAGG + Intergenic
1183445306 22:37849589-37849611 CTGAGGGCCGGGCGGGAGGTCGG - Intronic
1183453327 22:37907982-37908004 TTGAGGGGCAGGAGTGAGGCAGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183687468 22:39369477-39369499 CAGAGGACCAGCAGGGAGGAAGG - Intronic
1183727308 22:39596901-39596923 CTGAGTGTCAGGAGACAGAAAGG - Intronic
1184095212 22:42312696-42312718 CTGAGGCTCAGCAGGGATGGGGG - Intronic
1184123878 22:42472926-42472948 CTGAGAGGCAGGAGCCAGGAGGG + Intergenic
1184247866 22:43244826-43244848 CTGAGGGGCAGGGAGGAAGAAGG - Intronic
1184280798 22:43436379-43436401 CAGAGGGCCAGGAGTGAGGCAGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185399000 22:50606336-50606358 CTGGGGGGCAGTAGGGAGCAGGG + Intronic
949518178 3:4826021-4826043 CTTAGGTGCAGGAGAGAGGAAGG + Intronic
949518651 3:4829860-4829882 CTGAGGCTCAGGGGGAGGGAGGG - Intronic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
949815511 3:8053721-8053743 CCCAGGGTCTGGAGGGAGGGAGG + Intergenic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950077975 3:10200655-10200677 GTGAGGCTGAGGCGGGAGGATGG + Intronic
950190162 3:10970976-10970998 CTGAGGCTCAGGGAGGAGCAGGG + Intergenic
950433789 3:12966988-12967010 GTGAGGGGCAGGAGGGAGAGCGG - Intronic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950703542 3:14766536-14766558 CTGAGGGTGATGACGGAGGCAGG - Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953521179 3:43644783-43644805 CTGAAGGGCAAGTGGGAGGAAGG - Intronic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
953909214 3:46883319-46883341 GGGAGGGACAGGAGGGAGGGAGG - Intronic
954298318 3:49686252-49686274 CTGCGGGTGAGACGGGAGGAAGG - Intronic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954332083 3:49896509-49896531 GTGCTGGCCAGGAGGGAGGAAGG - Intronic
954479853 3:50788751-50788773 CTGAGGGCAAGGAGGGTGGCAGG + Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955286230 3:57644408-57644430 ATGAGGCTGAGGTGGGAGGATGG - Intronic
955349561 3:58183694-58183716 CTGAGGGTCCTAAGGTAGGAAGG + Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
956603892 3:71052231-71052253 CTGAGGGCCAGGATGGAGCTGGG - Intronic
957106153 3:75890188-75890210 CTGAGGGTCAGGAGTGTAGATGG - Intergenic
957551020 3:81704823-81704845 CTTAGAGTCTGGTGGGAGGAAGG - Intronic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
957810077 3:85210644-85210666 CCGAGGCTCAGGTGGGAGGATGG - Intronic
958184576 3:90104308-90104330 TTGAGGGTCAAAAGGCAGGAAGG + Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
960586740 3:119327033-119327055 CGGAGGCTGAGGTGGGAGGATGG + Intronic
960708505 3:120504593-120504615 CTGAAGGGCAGGAGAGAGGAGGG - Intergenic
960898804 3:122533411-122533433 CTGCAGGTCAGGAGAGAGGTAGG + Intronic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
961649634 3:128410926-128410948 CAGAGGCACAGAAGGGAGGAGGG + Intergenic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
961734004 3:128989259-128989281 CTTAGGGCCAGGAGGGACCAGGG - Intronic
961745024 3:129059279-129059301 CAGAGGCTCAAGAGGAAGGAGGG + Intergenic
961856289 3:129874750-129874772 GGGAGGGTGAGGTGGGAGGATGG + Intronic
961917544 3:130392936-130392958 CTGAGAGTCAAGGGAGAGGATGG - Intronic
962108505 3:132417663-132417685 GTGAGGGTGAGGAGGCCGGAGGG + Exonic
962116342 3:132512764-132512786 CTGAGGGTTAGGGGTGGGGATGG + Intronic
963513634 3:146279994-146280016 CAGAGGGTCAGCAGGAATGAGGG + Intergenic
964071420 3:152638071-152638093 GTGAAGGTCAGGAAGCAGGATGG - Intergenic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
965051175 3:163649636-163649658 CTGAAGCCCAGGAGGCAGGAAGG - Intergenic
965272093 3:166630161-166630183 ATGAAGGTGAGGAGGGAGGGAGG - Intergenic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
968216459 3:196895624-196895646 GGGAGGGTGAGGTGGGAGGATGG - Intronic
968317377 3:197736441-197736463 CTTAGGGTGAGGAGGGTGGGTGG - Intronic
1202745190 3_GL000221v1_random:94407-94429 CGGAGGGTGAGGTAGGAGGATGG - Intergenic
968720050 4:2195720-2195742 CTCAGGCTGAGGTGGGAGGATGG - Intronic
968880271 4:3294971-3294993 GGGAGGGTCAGGAGGTGGGAGGG + Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
969021476 4:4142817-4142839 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
969109050 4:4829910-4829932 AAGAGAGTCAGCAGGGAGGATGG + Intergenic
969456892 4:7305466-7305488 CTGAGCGCCATGTGGGAGGATGG - Intronic
969492548 4:7508234-7508256 ATGAAGGTCAGGAGGGAGGGAGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969632493 4:8346693-8346715 GGGAGGGTCAGGAGGCATGAAGG + Intergenic
969732390 4:8964600-8964622 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
969791971 4:9498683-9498705 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970156608 4:13148698-13148720 CTGAGAGTCAGGAATGAGTATGG + Intergenic
970619084 4:17798489-17798511 ATGAGGCTGAGGTGGGAGGATGG + Intergenic
971408901 4:26349170-26349192 AGGAGGGTGAGGTGGGAGGATGG - Intronic
971494810 4:27252279-27252301 CTCAGGGTCAAGGAGGAGGAGGG + Intergenic
972531402 4:39964462-39964484 CGGAGGCTGAGGTGGGAGGATGG + Intronic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
975765764 4:77666217-77666239 TTGAGGGGCGGGAGGGTGGAGGG + Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978507163 4:109471245-109471267 GTGAGGCTGAGGTGGGAGGATGG - Intronic
978702329 4:111662629-111662651 GGGAGGGGGAGGAGGGAGGATGG + Intergenic
978792201 4:112674520-112674542 CTCAAGGGCAGGACGGAGGAGGG + Intergenic
979138491 4:117141972-117141994 CAGAGGGTAAGGAGGGTGGGTGG + Intergenic
979187104 4:117810818-117810840 CTGAACGACAGGAGGCAGGAGGG - Intergenic
979745362 4:124206043-124206065 CAGAGGGTCAGGAGGTGGGGAGG + Intergenic
981170825 4:141621311-141621333 CTGAGGGTCAGGATGGACCGGGG - Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982718801 4:158838323-158838345 GTGAGGCTGAGGTGGGAGGATGG - Intronic
983204922 4:164902126-164902148 CTGGGAGCCAGGAGGGAGCAAGG - Intergenic
983339065 4:166434717-166434739 ATGAGGGGCAGGATGGAGGAGGG - Intergenic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985432984 4:189899474-189899496 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986315901 5:6586173-6586195 CTGAGTGCCAGGGAGGAGGAGGG - Intergenic
986819970 5:11455624-11455646 CTAAGAGGCAGAAGGGAGGAAGG - Intronic
987468158 5:18296725-18296747 CTGAGGGAGAGAAGGTAGGATGG + Intergenic
987901355 5:24015855-24015877 ATGAGGCTGAGGTGGGAGGATGG + Intronic
988226260 5:28415001-28415023 CTAAGGGTTGGGGGGGAGGAAGG + Intergenic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989494107 5:42091105-42091127 ATGAGGGTCATGAAGAAGGATGG - Intergenic
990830883 5:59955772-59955794 CCGAAGGGCAGGAGGGAGGGAGG - Intronic
991437239 5:66609492-66609514 GTGAGGCTAAGGTGGGAGGATGG - Intronic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
993069624 5:83144059-83144081 CTGAGACTCAGAAGGGGGGAAGG - Intronic
993141019 5:84033597-84033619 GTGAGGTTGAGGTGGGAGGATGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993281252 5:85927643-85927665 ATGAAGGTAAGGAGGGAGGGAGG - Intergenic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993514050 5:88807326-88807348 CGGAGGTTGAGGCGGGAGGATGG - Intronic
993802049 5:92354059-92354081 CTGTAAGTCAGGAAGGAGGAAGG + Intergenic
994267194 5:97731861-97731883 ATGAGGGACAGAAGGGAGTAAGG - Intergenic
994296002 5:98089332-98089354 CTCAGCCTCTGGAGGGAGGAGGG - Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995125355 5:108573258-108573280 CTAAGGGAGAAGAGGGAGGAAGG + Intergenic
995712015 5:115045387-115045409 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
995830075 5:116345241-116345263 CTCAGGGGTAGGAGGGAGGGGGG + Intronic
996741088 5:126799588-126799610 CTGAGGGTCCAGAAGAAGGAAGG + Intronic
996893604 5:128453913-128453935 GTGAGGTACAGGAGGGTGGAAGG - Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997554847 5:134787025-134787047 AGGAGGCTCAAGAGGGAGGACGG - Intronic
997956281 5:138280997-138281019 GGGAGGGTCAGGCAGGAGGATGG - Intergenic
998246827 5:140514387-140514409 GGGAGGGTGAGGTGGGAGGATGG + Intronic
998285863 5:140860274-140860296 GGGAGGGTGAGGTGGGAGGACGG + Intronic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998385259 5:141753699-141753721 CTGAAGGGCGGGAGAGAGGAGGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999213010 5:149906584-149906606 ATGAGGCTCAAGAGGGAGGAAGG - Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000136113 5:158352656-158352678 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1000968802 5:167691578-167691600 CTGAGGGACAGAAGCGGGGAAGG - Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001854247 5:174996947-174996969 TTGAGGATCAGCAGTGAGGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001962841 5:175890640-175890662 CACAGGTGCAGGAGGGAGGAGGG - Intergenic
1002009797 5:176269848-176269870 GGGAGGCTCAGAAGGGAGGACGG - Intronic
1002025272 5:176392592-176392614 CAGAGGGCCAGGAGGGAGCGAGG + Exonic
1002194670 5:177495453-177495475 CTGGGGGTCAGGAGGGGGTGGGG - Intronic
1002280857 5:178129448-178129470 GTGAGGGTTAGGAAGGAGGAGGG - Intergenic
1002483925 5:179522316-179522338 CGGAAGGCCAGGAGGGTGGAGGG + Intergenic
1002500638 5:179645165-179645187 CGGAAGGCCAGGAGGGTGGAGGG - Intergenic
1002690851 5:181049553-181049575 CTGAGGGTGAGGTGTGATGACGG + Intronic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002888793 6:1317033-1317055 CTGGGGGGGAGGCGGGAGGAGGG - Intergenic
1003053017 6:2796923-2796945 TTGAAGGGCAGGAAGGAGGAGGG + Intergenic
1003379580 6:5611238-5611260 CTGAGGGCCAGAAGTGAGGTAGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004360599 6:14967466-14967488 CAGAGGCTCACGTGGGAGGATGG + Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1004495566 6:16159773-16159795 CTGAGGGTCAGCAAGAAGGATGG + Intergenic
1004560486 6:16744614-16744636 GTGAGGGGCAGGTGGGAGAAGGG + Intronic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006083709 6:31581772-31581794 CTGAGGGTCTGAAGCGGGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006277866 6:33020673-33020695 GATAGGGTCAGGAAGGAGGATGG - Intergenic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006623148 6:35381210-35381232 CTGGAGGTCAGGAGGAGGGAAGG - Intronic
1006772749 6:36567271-36567293 AGGAGGGTGAGGTGGGAGGATGG + Intergenic
1006778671 6:36616929-36616951 CTGAGGCCCAGGGAGGAGGAGGG + Intergenic
1006936050 6:37718952-37718974 GGGAGGGTGAGGTGGGAGGATGG + Intergenic
1007171230 6:39864957-39864979 CTGAGGGCCAGCAGGTAGAAAGG - Intronic
1007286569 6:40752102-40752124 CTGAAGGTCAGTAGTGAAGAGGG - Intergenic
1007325042 6:41053301-41053323 CTGAGGGAGAGGAGAGAGGCAGG - Exonic
1007341561 6:41194167-41194189 AGGAGGGTCAGTGGGGAGGAGGG - Intronic
1007341591 6:41194234-41194256 AGGAGGGGCAGGAGAGAGGAGGG - Intronic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007737589 6:43991158-43991180 CTGAGGGCCAAGGGGAAGGACGG - Intergenic
1007785360 6:44276552-44276574 GCGAGGGGCAGGCGGGAGGACGG - Exonic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008435085 6:51466615-51466637 CGGAGGGATAAGAGGGAGGAGGG - Intergenic
1009042730 6:58199474-58199496 TTGAGAGTCAGGAGGGAGAGAGG + Intergenic
1010800510 6:80168852-80168874 CTGAGGGTCAGAAAGAAAGACGG - Intronic
1011001015 6:82588711-82588733 CAGAGGCTAAGGTGGGAGGATGG + Intergenic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1012943153 6:105438513-105438535 GTGAGAGGGAGGAGGGAGGAAGG - Intergenic
1013180638 6:107714337-107714359 GGGAGGGTCAGTAGGGAGGAGGG - Intronic
1013538460 6:111085058-111085080 GGGAGGCTCAGGTGGGAGGATGG - Intergenic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014150203 6:118045652-118045674 ATGAGGTTCTGGAAGGAGGATGG + Intronic
1015201141 6:130582745-130582767 CTGAGGAGCAGGAGGGAGCTAGG + Intergenic
1015414264 6:132930885-132930907 CTGAGCAGCAGGAGGGAGGGTGG + Intergenic
1015807998 6:137131940-137131962 CTGAGAGTCAGAAAGAAGGAAGG + Intergenic
1016045843 6:139479635-139479657 CAGAGTGTCAGGATGGAGGAGGG + Intergenic
1016390161 6:143566396-143566418 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016439327 6:144067286-144067308 GTGAGAGCGAGGAGGGAGGAGGG + Intergenic
1016827424 6:148401147-148401169 CGGAGGTTAAGGTGGGAGGATGG + Intronic
1016841924 6:148533517-148533539 CTGCAGGGCAGGAGGGTGGAGGG + Intronic
1016920785 6:149290738-149290760 AGGAGGCTCAGGTGGGAGGATGG + Intronic
1016982453 6:149864894-149864916 CTGAGGCTGAGTTGGGAGGATGG + Intergenic
1017300794 6:152855482-152855504 GTGAGGGAGAGGAGTGAGGATGG + Intergenic
1017324410 6:153130217-153130239 ATGAGGGACAGCAGGGAGGCTGG + Intronic
1017766417 6:157610576-157610598 CTGGAGGTCAGGATGGAGGGAGG + Intronic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018982756 6:168613223-168613245 CTGGGGGTCAGGAAGGTGCAGGG + Intronic
1019020100 6:168911180-168911202 AGGAGGGTGAGGTGGGAGGACGG + Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019106470 6:169671649-169671671 GTGAGGGTGAGAAGGGATGAAGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019320709 7:414216-414238 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320717 7:414232-414254 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320725 7:414248-414270 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320749 7:414310-414332 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320763 7:414342-414364 AGGAGGGGGAGGAGGGAGGATGG - Intergenic
1019320770 7:414358-414380 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019577186 7:1743255-1743277 CTGAGGGTCTCCAGGCAGGACGG - Intronic
1019637881 7:2086100-2086122 CTGCTGGCCAGGAGGGAGGGAGG - Intronic
1019655391 7:2191624-2191646 CAGAGGCTCAGGTGGGAGAATGG + Intronic
1019658542 7:2210824-2210846 CTGATGGCCAGGAAGGTGGATGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019806465 7:3129933-3129955 GTGAGGGGAAGGAGGGAGGGAGG + Intergenic
1019823106 7:3260725-3260747 CTGAGGGCCAGGAGGGAATTTGG - Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1020065742 7:5187279-5187301 CAGAGGCTAAGGCGGGAGGATGG - Intergenic
1020184906 7:5951571-5951593 GGGAGGGTGAGGTGGGAGGATGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020298010 7:6773173-6773195 GGGAGGGTGAGGTGGGAGGATGG + Intronic
1020308898 7:6854846-6854868 CGGGGCCTCAGGAGGGAGGAGGG + Intergenic
1020901549 7:14009652-14009674 CTGAGGGGCTGGATGGAGGGAGG - Intergenic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021222435 7:17989622-17989644 CGGAGGGTGAGGCAGGAGGATGG - Intergenic
1021352280 7:19609903-19609925 AGGAAGGTCAGGAGGGAGGAAGG - Intergenic
1021355600 7:19650691-19650713 CTGAGGCTCTGGAGTGAGCATGG + Intergenic
1021730260 7:23588655-23588677 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022410867 7:30137229-30137251 CACACGGTCAGGAGGGAGAAAGG - Intronic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022796039 7:33732023-33732045 GTGAGGCTCAGGAGGGTGTAAGG - Intergenic
1022796510 7:33735665-33735687 CTGAGTGTCAGTGAGGAGGATGG - Intergenic
1022902598 7:34825603-34825625 CTGAAGGTCACCAGGGAGGGTGG + Intronic
1023058218 7:36306630-36306652 CTCAGGGTCAGCAATGAGGAAGG - Intergenic
1023905992 7:44521837-44521859 CTAAGGGGCAGGTGGGAGGAAGG + Intronic
1023974852 7:45021150-45021172 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1024531301 7:50394609-50394631 CTGAGGCTCAGAAGGGGTGATGG + Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024820349 7:53322146-53322168 CTAAGGAACAGGAGGCAGGAGGG + Intergenic
1025019181 7:55467311-55467333 GTGAGGGGCAGGAGGGAGTCAGG + Intronic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026203628 7:68236555-68236577 CTGAGATGCAGGAGAGAGGAGGG + Intergenic
1026275452 7:68872088-68872110 CTGAGGGTCAGGGAGGGGGTGGG - Intergenic
1026309040 7:69167816-69167838 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1026734458 7:72940906-72940928 CTTGGGGCCAGGAGGGAGGTGGG - Exonic
1026784790 7:73295814-73295836 CTTGGGGCCAGGAGGGAGGTGGG - Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026877172 7:73886481-73886503 CTCTGGGACAGGAGGGAGGCGGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027109286 7:75424114-75424136 CTTGGGGCCAGGAGGGAGGTGGG + Exonic
1028420424 7:90626698-90626720 CAGAGGCTAAGGTGGGAGGATGG + Intronic
1028548794 7:92033548-92033570 GGGAGGCTCAGGTGGGAGGATGG - Intronic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1028698311 7:93744214-93744236 GTGAAGATCAGGAGGAAGGAAGG + Intronic
1028711981 7:93919983-93920005 CGGAGGCTCAGGCGGGAGAATGG + Intergenic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029248788 7:99221555-99221577 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029492325 7:100878205-100878227 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1029547564 7:101218376-101218398 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1029630738 7:101748475-101748497 CTGAGGCTCGGGTGGGGGGAGGG + Intergenic
1029892090 7:103941082-103941104 CTGATGGTGAGGGGGCAGGAAGG - Intronic
1031549786 7:123094717-123094739 CTGAGGGACAGGAGGAAGAGAGG + Intergenic
1031584650 7:123519642-123519664 GAGAAGGGCAGGAGGGAGGAAGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032193165 7:129775810-129775832 CGGAGGCTCAGGAGCGAGGGAGG + Intergenic
1032284271 7:130528947-130528969 ATGAAGGACAGGAGGGAGGATGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033334435 7:140440357-140440379 GGGAGGGTGAGGTGGGAGGATGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033343483 7:140509800-140509822 TCGAGGGTGAGGTGGGAGGATGG - Intergenic
1033452697 7:141475710-141475732 CTTAGGGGCAGGATGGAGCAGGG + Exonic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034820821 7:154214811-154214833 AGGAGGCTCAGGTGGGAGGATGG + Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035230554 7:157463533-157463555 ATGAGGGTGAGGGGTGAGGATGG - Intergenic
1035252679 7:157607487-157607509 AGCAGGGTCAGGAGGGAGCAGGG + Intronic
1035336130 7:158128012-158128034 CTGAGGTTCAGATGGGAGGATGG - Intronic
1035414367 7:158670459-158670481 GGGAGGCTCAGGAGGGATGATGG + Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035496021 7:159326881-159326903 CAGATGGACAGGAGGGAGCAAGG - Intergenic
1035658175 8:1327121-1327143 CTCAGTGTCAGGAGGATGGAAGG - Intergenic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036646190 8:10612509-10612531 CCGAGGGCCCGGAGTGAGGAGGG - Exonic
1036815777 8:11902047-11902069 CCGAGGCTCAGGTGGGAGGATGG - Intergenic
1037365163 8:18114587-18114609 GCGAGGGGCAGGAGGGAGGTAGG - Intergenic
1037810088 8:22081753-22081775 CAGAGGGTGAGGAGGAATGAGGG + Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038068405 8:23986900-23986922 CTGATGCACAGGAGAGAGGAGGG + Intergenic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038349042 8:26760004-26760026 CTGAGAGTCCCCAGGGAGGAAGG + Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038584661 8:28778048-28778070 CAGGGGGTCAGGAGGGAGCCAGG + Intronic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1038905463 8:31897254-31897276 CTGAGTTCCAGAAGGGAGGAGGG - Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1039545959 8:38411805-38411827 CTGAGGGACAGGATGGAGTTTGG + Exonic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1039864096 8:41486122-41486144 GTGAGGGTCAGGTGGGAGTAGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042487312 8:69361044-69361066 AAGAGGGTCAGGAGACAGGAGGG - Intergenic
1042604404 8:70531169-70531191 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043088247 8:75865077-75865099 ATGAGGGTCAGGAGGGATGGAGG - Intergenic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1043888500 8:85630389-85630411 CAGAGGCTCAGGTGGGAGGACGG + Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044551071 8:93512989-93513011 CAGAGGGTGGGAAGGGAGGAGGG + Intergenic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044874645 8:96653034-96653056 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1045048114 8:98298333-98298355 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045683701 8:104689634-104689656 ATGAGGGCTAGGAGTGAGGATGG + Intronic
1045844301 8:106615501-106615523 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046255778 8:111694583-111694605 CTTAGGTTCTGGAGGGAGCAGGG - Intergenic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048047382 8:130785657-130785679 CTAAGGGTCAGGAGTGGAGATGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048200132 8:132365924-132365946 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1048205792 8:132414283-132414305 CAGAGAGTCAGGAGGGAGCAGGG + Intronic
1048303051 8:133265525-133265547 AGGAAGGGCAGGAGGGAGGATGG - Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048453367 8:134554145-134554167 CTGGGAGTCAGGAGCAAGGAGGG - Intronic
1048528892 8:135229494-135229516 CTGAGTGTCAGGAGGGATTACGG + Intergenic
1048568328 8:135627310-135627332 CTGAGGTTCAGGCAGGAAGAAGG + Intronic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1048971664 8:139648509-139648531 CAGAGGGACAGGAGGCAGGCTGG - Intronic
1049097628 8:140558227-140558249 GTGAGGCTCAGGAAGGAAGAGGG + Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1049482749 8:142834727-142834749 TTGAGGGTCCGGAAGGAGGGCGG + Intronic
1049558319 8:143294848-143294870 AGGAGGCTCAGGTGGGAGGAGGG + Intronic
1049570492 8:143368188-143368210 CGGAGGTTCTGGAGGGAGGCGGG + Intergenic
1049597702 8:143492338-143492360 CTGAGGCCCTGGTGGGAGGAGGG - Intronic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049672804 8:143877312-143877334 CAGAGGGTCCGGAGCGAGGGGGG + Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049718820 8:144106242-144106264 GTGAGGGTCAGGTGGAGGGAAGG + Intronic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1052848032 9:33354591-33354613 CTGAAGGACAGGTGGGATGATGG - Intronic
1053025121 9:34723218-34723240 GTGAGGGTCAGGAGCTAGGTTGG + Exonic
1053036650 9:34832281-34832303 CTGAGGGTTAGGAGCTAGGGTGG + Intergenic
1053084993 9:35211854-35211876 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053370172 9:37554225-37554247 GTTAGGGACAGGAGAGAGGAGGG - Intronic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1053751956 9:41266199-41266221 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054257479 9:62830529-62830551 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054333836 9:63785193-63785215 CTCAGGCGCAGGAGGGATGACGG - Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1054909088 9:70437689-70437711 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1055497114 9:76866858-76866880 CGGATGGTCAGAAGGGAGGGAGG + Intronic
1055514535 9:77022170-77022192 CTGGGGCTCAAGAGGGGGGAAGG - Intergenic
1055899016 9:81213140-81213162 TTGATGGTCAGGAGGGGGTAGGG + Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1057211808 9:93204588-93204610 CTGAGGGGCAGGGGTGGGGAAGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057519690 9:95751498-95751520 CTGAGCTGCAGGAGGGAGGGAGG + Intergenic
1057519728 9:95751610-95751632 CTGAGCTGCAAGAGGGAGGATGG + Intergenic
1057519785 9:95751785-95751807 CTGAGCTGCAGGAGGGAGGGAGG + Intergenic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058618839 9:106862707-106862729 CTGGGGTTCAGCAGGGGGGAGGG + Intergenic
1058793198 9:108471536-108471558 CTGAGGCTAAGGCAGGAGGATGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1058910072 9:109512895-109512917 CTTAGGGGCAGGAGGAGGGAGGG - Intergenic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059000620 9:110344558-110344580 AGGAGGGTGAGGTGGGAGGATGG - Intergenic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059455058 9:114395097-114395119 CTGGGGTGCAGGAGGGAGGGAGG + Intergenic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1060198154 9:121636427-121636449 TTCAGGAGCAGGAGGGAGGAGGG + Intronic
1060434387 9:123581148-123581170 CTGTGGGTCAAGCGGGAGTAAGG + Intronic
1060444903 9:123679077-123679099 CTGAAAGTCAGGAGGCAGGGGGG + Intronic
1060769040 9:126317480-126317502 CCAAGGGTCAGGAGGGAGAGAGG + Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060885133 9:127146218-127146240 ATTAGAGGCAGGAGGGAGGAGGG - Intronic
1061004351 9:127920157-127920179 CTGAGGGGGAAGGGGGAGGAAGG - Intergenic
1061045583 9:128163312-128163334 CTGAGGCTCAGGAAGCAGTAGGG + Intronic
1061138820 9:128752146-128752168 CTGAGGATCAGGAAGGAAGGAGG - Intronic
1061292411 9:129658694-129658716 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1061391651 9:130320333-130320355 CTGAGGGGCACGAGAGAGGCAGG - Intronic
1061511323 9:131062908-131062930 ATCAGGGGCTGGAGGGAGGAAGG - Intronic
1061617265 9:131788486-131788508 CTCAGCCTCAGGAGGGAGGCTGG + Intergenic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1061906714 9:133702865-133702887 CTGAGGGACAGGCAGAAGGACGG + Intronic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062530506 9:136997484-136997506 GTCAGGGCCAGGTGGGAGGAAGG - Intergenic
1062542637 9:137048428-137048450 CTGAGGGTGGGGTGGAAGGATGG + Exonic
1062555334 9:137111236-137111258 CTGAGGGTGAGACGGGAGCAGGG + Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062590350 9:137271836-137271858 CCCAGGGACAGGAGGGTGGAGGG - Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1203453035 Un_GL000219v1:138451-138473 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1203713814 Un_KI270742v1:124358-124380 CGGAGGGTGAGGTAGGAGGATGG - Intergenic
1185551457 X:985479-985501 GGGAGGCTCAGGTGGGAGGATGG - Intergenic
1185763938 X:2709094-2709116 CTGAGGGTGATGGAGGAGGATGG + Intronic
1185780797 X:2843155-2843177 CTGAGGGACAGCAGGGGTGACGG - Intronic
1185854225 X:3519396-3519418 CGGAGGCTGAGGCGGGAGGATGG - Intergenic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1186100583 X:6152053-6152075 GGGAGGGTGAGGCGGGAGGATGG - Intronic
1186137305 X:6533575-6533597 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186214087 X:7280624-7280646 TTGGGGGTCAGGTGGAAGGATGG + Intronic
1186267139 X:7844164-7844186 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186298006 X:8169901-8169923 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186324844 X:8466531-8466553 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186344569 X:8678609-8678631 CTGAGGGTCAGAAGGAATAATGG - Intronic
1186441000 X:9586659-9586681 GGGAGGCTCAGGTGGGAGGATGG + Intronic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1188515144 X:30977402-30977424 CTGAGAGTGAGGAGGCAGAAAGG - Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1189638008 X:43033093-43033115 CTGAGAATCAGGAGGGCTGATGG - Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190078240 X:47334668-47334690 AGGAGGGTGAGGTGGGAGGAAGG + Intergenic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1190260775 X:48795486-48795508 CTGTGGGTCAGGCGGCAGGCTGG + Intergenic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1190789045 X:53682856-53682878 CTGAGGGGGAGGAATGAGGAAGG + Intronic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1192310843 X:70012958-70012980 CTCAGGCTCAGGAGAGAGCAAGG + Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1193143159 X:78050853-78050875 CTCAGGGTGAGGAGATAGGATGG + Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1193882077 X:86935950-86935972 CTAATGTTCAGGAGGGATGAAGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1194746240 X:97631375-97631397 TAGAGGGTCAGGAAGGAGTAGGG + Intergenic
1195234047 X:102879533-102879555 CTCAGGGTCAGGAAGGCGGGTGG - Intergenic
1195708574 X:107756612-107756634 CTGAGAGGAAGGAGGGAGGGAGG - Intronic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196375645 X:115029710-115029732 GAGAGGGCCAGGAGAGAGGAGGG - Intergenic
1196683983 X:118495576-118495598 GCGAGGGTCACGAGGGAAGAGGG - Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197321019 X:125031104-125031126 CTTAGAGTGGGGAGGGAGGAGGG - Intergenic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197894636 X:131298781-131298803 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1199207148 X:145161996-145162018 GTGAGGCTGAGGTGGGAGGATGG + Intergenic
1199757679 X:150880531-150880553 CTGAGGGCCAGGGGGAAGGTGGG + Intronic
1199795924 X:151196761-151196783 GTGGGGGTCAGGTGGGGGGATGG - Intergenic
1199868054 X:151872084-151872106 TTGAGGGTGAAGAGGTAGGAAGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200266920 X:154651516-154651538 GGGAGGCTCAGGTGGGAGGATGG - Intergenic
1200315310 X:155126406-155126428 ATGAGGGGTAGGAGGGAGCAGGG + Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200957535 Y:8967154-8967176 GTGAGGGACGGGAGGGAGGGAGG - Intergenic
1201438682 Y:13985729-13985751 CTGATGGTGAGGAGGGAGGGAGG - Intergenic
1201445891 Y:14056979-14057001 CTGATGGTGAGGAGGGAGGGAGG + Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic
1202086446 Y:21141686-21141708 CTAAGGGTTTGGAGGCAGGAGGG - Intergenic